1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stealth61 [152]
3 years ago
6

Describe the specialized characteristics of human red blood cells and explain how these characteristics help red blood cells to

accomplish their function.
Biology
1 answer:
sasho [114]3 years ago
7 0

Answer:The characteristics of red blood cells is that they are usually concave in shape, and usually have a fair bit of surface area on them. Immature red blood cells like reticulocytes are more squashed like. The function of red blood cells is to carry oxygen, and/or carbon dioxide to various portions of the body.

Explanation:

You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Is stoarage a function of a carb
polet [3.4K]

Answer:

No, carbs give us energy.

8 0
3 years ago
Which part of the compound light microscope is used to change magnification?
coldgirl [10]

Answer: Part C

That’s correct because it contains the lenses magnification.

8 0
3 years ago
What is uncontrolled Chain Reaction called​
slega [8]
A stupid mistake made from the very beginning
4 0
3 years ago
Read 2 more answers
Scientists around the world have been working for decades on perfecting the process of nuclear fusion in the lab. Which statemen
Nezavi [6.7K]

<span>Scientists are looking for a way to create cheap, safe, and sustainable energy.

Nuclear fusion is the process by which two atoms rapidly collide at each other forming a new nucleus. The energy of colliding and synthesizing has intrigued scientist into believing that this could be one of best sources of renewable energy. </span>
8 0
3 years ago
Read 2 more answers
Other questions:
  • The image shows an ant that has been infected by a fungus, with the sporangium of the fungus emerging from the ant’s head. What
    9·1 answer
  • List some cell types in which mitosis is expected to occur. List a cell type in which meiosis is expected to occur.
    14·2 answers
  • Hurry its timed! 25 points! branliest!
    5·2 answers
  • what can you infer about how cell division in a normal cell compares to cell division in cancerous cells?​
    14·1 answer
  • Match each type of cell junction with its description.
    9·1 answer
  • What is the definition of bond
    11·2 answers
  • If purple flower color is dominant and red flower color recessive, how many phenotypes are possible in offspring of homozygous p
    9·1 answer
  • Please answer the following questions correctly​
    8·1 answer
  • For the next question, you will be given two scenarios. For each scenario, identify the relationship that exists: mutualism, pre
    9·2 answers
  • bones are evidence of which type of pre-existing life? responses neither plants nor animals neither plants nor animals animals a
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!