1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lana66690 [7]
3 years ago
12

What household item represents nucleolus

Biology
1 answer:
Ugo [173]3 years ago
5 0
You could say the refrigerator or microwave
You might be interested in
Valcanoes are_____found where two places meet.<br><br> A.never<br> B.rarely<br> C.often<br> D.always
andrew11 [14]
C. often because t<span>here are three major types of </span>plate<span> boundaries. If </span>two<span> tectonic </span>plates<span> collide, they form a convergent </span>plate<span> boundary. Usually, one of the converging </span>plates<span> will move beneath the other, which is known as subduction. Deep trenches are often formed where tectonic </span>plates<span> are being subducted and earthquakes are common</span>
8 0
3 years ago
Is the practice of genetically modifying human cells ethical? Why or why not?
kumpel [21]

It totally depends upon whether modification is being done in somatic cells or germ cells. Somatic cells modification is ethically accepted because it doesn't pass from one generation to another generation but germline modification is considered as unethical because the modification will pass on to the next generation leading to the persistence of modification in future generations. The problem with genetic modifications is that the impacts of modifications are unpredictable, rather than being fruitful they may lead to lethal mutations so if it occurs in just somatic cells, then even if it is lethal/harmful, it will be confined to only that individual but if a lethal mutation occurs in germ cells then it will pass on to the subsequent generations and it will persist in all future generations.

8 0
2 years ago
Primary consumers depend on energy from plants for survival. Higher consumers depend on energy from primary consumers for surviv
yaroslaw [1]
The answer is C
The more plants there are, the more consumers there are. If there aren't enough plants, the consumers have no way of getting energy, and therefore cannot survive. The species also matters, because certain species of plants can only be eaten by certain species of consumers.
4 0
3 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
2 years ago
Can someone pls help me<br>​
Black_prince [1.1K]

Answer:

16. mitochondria

17. lysosomes

18. smooth Endoplasmic Reticulum

19. golgi body

20. golgi complex

Explanation:

16. Mitochondria are double membrane-bound cell organelles responsible for the supply and storage of energy for the cell

17.  While cells mainly use lysosomes to dispose of trash. Sometimes they simply hang onto their trash, performing the cellular equivalent of sweeping it under the rug

18. Are the storage organelle, associated with the production of lipids, steroids, and also responsible for detoxifying the cell.

19.  The Golgi body is the sorting organelle of the cell. Proteins are transported from the rough endoplasmic reticulum (RER) to the Golgi.

20. is responsible for sorting and correctly shipping the proteins produce the ER. Just like our postal packages, which should have a correct shipping address, the proteins produced in the ER should be correctly sent to their respective address. It is a very important step in protein synthesis.

__________________________________________________________

Hope this helps!!

If I am wrong, please tell me, I enjoy learning from my mistakes:)

6 0
2 years ago
Other questions:
  • What signal transduction mechanism is most commonly utilized by the receptor for glucagon?
    9·1 answer
  • What is the energy released during cell respiration
    11·2 answers
  • There are two different species of finch that live on the same small island, species A and
    9·1 answer
  • Thr process of ________ increases genetic variability as it produces gametes for sexual reproduction
    12·1 answer
  • Rory has been diagnosed with ADHD. He is often impulsive and is prone to emotional outbursts. He has difficulty making plans and
    12·1 answer
  • Which of the following promotes closure of the minivalves associated with lymph capillaries?
    13·1 answer
  • Rain forests cover just 6 percent of the Earth’s land surface, yet they contain _____ percent of Earth’s species. 30 60 70 40
    6·2 answers
  • Vitaminlerin insan sağlığı açısından önemi ile görseller içeren bir tablo​
    13·1 answer
  • Where are peripheral proteins located
    7·1 answer
  • Which domain is considered to be the oldest?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!