1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lana66690 [7]
3 years ago
12

What household item represents nucleolus

Biology
1 answer:
Ugo [173]3 years ago
5 0
You could say the refrigerator or microwave
You might be interested in
What is the mRNA copy of the DNA strand: TAC AAA GTT AGA GAG TAG ATC
Nitella [24]

Answer:

AUG UUU CAA UCU CUC AUC UAG

Explanation:

4 0
2 years ago
Melas is a recently described disorder that is related to improper energy relationships within cells. which structure organelle
Rasek [7]
I believe the structure organelle that may be faulty is Mitochondria. Mitochondria is a cellular organelle that is involved in cellular respiration a process that uses glucose to yield water and carbon dioxide coupled with production of energy in the form of ATP. Melas meaning mitochondrial encephalomyopathy lactic acidosis and stroke-like episodes is a conditions that affects body systems especially the brain and the nervous system and muscles.
7 0
2 years ago
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
When an environment is hypotonic what happens to the cell?​
Inessa [10]

Answer:

Cells placed in a hypotonic solution will take in water across their membrane until both the external solution and the cytosol are isotonic. A cell that does not have a rigid cell wall, such as a red blood cell, will swell and lyse (burst) when placed in a hypotonic solution.

Explanation:

Hope this helps! Brainly me if you want! <3

4 0
2 years ago
Which sentence best explains how a positive feedback loop affects climate
meriva

Answer:

A

Explanation:

Based on the word choice and structure of the sentence, A gives off the most positive connotation upon reading out of all of your choices.

Hope this helps!

8 0
3 years ago
Read 2 more answers
Other questions:
  • Which event is likely to trigger succession
    8·1 answer
  • What can create submarine canyons by cutting through bottom sediments and bedrocks of seafloors
    12·1 answer
  • What is meant by crossing over?
    8·2 answers
  • The energy stored in ATP is released when a_______is removed from the molcecule?
    7·1 answer
  • Why does the human body maintain a constant pH of its blood
    9·1 answer
  • Which is true of prokaryotic and eukaryotic cells?
    10·1 answer
  • What is the highest mountain in north america,how high is it?
    12·1 answer
  • having hair on the back of the hand is dominant (H) and not having the hair is recessive (h) a mother has Hh and a father has hh
    15·1 answer
  • 7. Apply Concepts Tsunamis can travel across great distances, including entire oceans.
    14·1 answer
  • Explain how it is possible for nutrients to be transported to the cells of a flatworm with no circulatory system.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!