1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
skelet666 [1.2K]
3 years ago
9

Based on your observations from the Can Crush Lab, why would a helium balloon that rises into the atmosphere eventually burst?

Biology
1 answer:
lina2011 [118]3 years ago
7 0
The air in balloon is at a higher pressure than the sorrounding air .
The night pressure of the air that was inside the balloon is now free to expand and it creates a pressure that makes it pop
You might be interested in
The largest organ in the body is the _______.
Inga [223]
A: Skin. heart is a organ but it's sorta small. Same with liver.  Skeleton is not a organ
3 0
3 years ago
Read 2 more answers
Can sum1 help me wit dis
Lelu [443]
Hello, this is the completion: UUC CGA UAG UCG CUC GCA ACU ACG CGC UGH AGA ACU Hope this help, please double check before submitting:)
6 0
3 years ago
The presence or absence of freckles is determined by one gene. The allele for freckles (F) is dominant and the allele for the ab
il63 [147K]

Answer:

There are no options to this question, however, the question can be answered. The answer is:

FF and FF/Ff

Explanation:

This question involves a single gene coding for possession or not of freckles in humans. The allele for freckles (F) is dominant over the allele for no freckles (f). This means that genotypes FF and Ff (heterozygous) will possess freckles while only genotype ff will not.

According to this question, a couple has several children in which all of the children have freckles i.e. have either genotype FF or Ff. This is as a result of the fact that the parent's genotypes were either FF or Ff. That is, one parent is FF while the other is either FF or Ff. This genotypes will only produce children with freckles.

3 0
3 years ago
Protist has the most organelles and is more complex than the rest​
Bess [88]

Explanation:

is this a true or false question?

4 0
3 years ago
Grasslands are areas between the forests and deserts. The table below shows the amount of species per section of each of the bio
Natali5045456 [20]

Answer: it will be the second one.

Explanation:

☆ツ

5 0
3 years ago
Other questions:
  • The _____ of exercise determines the health and fitness benefits of the exercise.
    13·1 answer
  • Harrison wanted to find out what soil works best for growing roses. He grew them in potting soil, clay, sand, and soil he found
    10·1 answer
  • I need help ASAP please
    13·1 answer
  • What forms the majority of the plasma membrane of cells
    14·2 answers
  • Active transport is used to transport very large<br> molecules.<br> True<br> False
    10·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Directions
    15·1 answer
  • Which of the following steps is an important part of the process by which ecology guides humans to a sustainable future? A. The
    7·2 answers
  • 5. Which is the function of ribosomes?
    8·2 answers
  • In light of the pandemic we are living through, do you think vaccinations should be mandatory?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!