1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KATRIN_1 [288]
3 years ago
15

A carbohydrate found in bread and pasta:

Biology
2 answers:
Dimas [21]3 years ago
7 0

Answer:

yes

Explanation:

yes they are found in bread and pasta

anastassius [24]3 years ago
6 0
If you’re trying to figure out if it’s true or false it’s true
You might be interested in
The appearance of banded iron layers in the rock record between 1.08 and 3.8 billion years ago reflect the alteration of oxygen-
lyudmila [28]

The appearance of banded iron layers in the rock record between 1.08 and 3.8 billion years ago reflect the alteration of oxygen-rich and oxygen-poor conditions in the ocean at that time is True.

<u>Explanation:</u>

Banded rocks have layers of iron oxide and cherts that contain silica. The layer containing iron oxide has a dark color and the chert layer is red in color. Haematite and magnetite are usually the iron oxides that make up the banded rocks.

Banded rocks were formed by the reaction of iron in the oceans with the oxygen produces by photosynthetic bacteria in the ocean. The reaction caused the formation of iron oxides and their precipitation as Banded iron formations.

The presence of free oxygen is crucial for the formation of banded rocks and the formation reduced drastically after 1800 mya period when  atmospheric oxygen availability was reduced.  Banded rocks represent the oxygen rich and oxygen-poor condition of the ocean at that time.

5 0
3 years ago
What is the role of a scientist?
Fofino [41]

idk a person that does science

7 0
3 years ago
Read 2 more answers
What can be said about the maximum duration of lunar and solar eclipses?
Julli [10]
<span>Lunar eclipses-maximum duration
1 HR 40 min (total)
and
3 hours 40 minutes (partial-total-partial).<span>

Solar eclipse-maximum duration
7 min 40 Sec (total at the equator)
and
12 min 24 Sec for annular eclipses.</span></span>
5 0
3 years ago
Based on the arrows, what does the image represent?
Karolina [17]

Answer:

I think the answer is B i might be mistaken though c:

Explanation:

4 0
3 years ago
Which of the following is an example of competition that could be found int the ocean
Elena-2011 [213]
It would be shark againts fish i think

4 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Animals are removed from an area. what effect would this have on the plants?
    8·1 answer
  • A hernia in the groin area is called a/an
    10·1 answer
  • How do you figure out the saturation of a substance
    10·1 answer
  • What is the study of the atmosphere and the processes that produce weather and climate?
    14·1 answer
  • How do semantic and episodic memories differ?
    6·1 answer
  • Although most animals are bilaterally symmetrical, a few exhibit radial symmetry. What is an advantage of radial symmetry?
    7·2 answers
  • Plz help ASAP thanks!!
    5·1 answer
  • 4
    8·2 answers
  • Symbiotic relationship between two species in which one organisms benefits and causing harm to the other
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!