1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katena32 [7]
3 years ago
8

What structure is found in some but not all plant cells

Biology
1 answer:
WARRIOR [948]3 years ago
3 0
Most organelles are common to both animal and plant cells. However, plant cells also have features that animal cells do not have: a cell wall, a large central vacuole, and plastids such as chloroplasts.
You might be interested in
Viruses do not possess all the characteristics of life. Identify those characteristics that viruses display and those they don’t
Otrada [13]

A Virus is also a part of one of the domains of life, The Domain that includes viruses is the Domain Archaea

6 0
3 years ago
Which is the best explaination of a recessive gene?
Elanso [62]
Answer: A gene that is hidden or not expressed.
8 0
3 years ago
Read 2 more answers
Is food energy a type of potential or kinetic energy?
julsineya [31]
Potential energy because when your body breaks down the molecules the energy  is released that it can use to do work, like walk or think.
3 0
3 years ago
What kind of scientist would use a dichotomous key?
Vadim26 [7]

Answer:

Many scientists use dichotomous keys to identify plants, animals, and other organisms. They may also use dichotomous keys to identify species, or to determine whether a particular organism has been identified and described before. However, dichotomous keys are not used only to identify organisms.

7 0
3 years ago
Fungi of the phylum Basidiomycota form mycorrhizal associations with orchids, a type of flowering plant. How do these associatio
alexandr1967 [171]

The answer is; A

This is a symbiotic relationship. The mycorrhiza is harbored I the roots of the orchids. The fungi nitrify the soil around the plant. Therefore, the fungi make nitrates (which are critical for the growth of the plant) available to the plant. The fungi, on the other hand, are assisted in breaking down of large carbon polymers by the orchids because the plant’s enzyme is more powerful than those of the fungi.


5 0
3 years ago
Read 2 more answers
Other questions:
  • Oceanic crust is generally lower in elevation than continental crust because oceanic _____ is _____ than continental crust.
    10·1 answer
  • Is marijuana intoxicated driving more dangerous that alcoholic intoxicated driving?
    7·1 answer
  • Organisims that have catalase
    12·1 answer
  • Which of the following statements about the cytoskeleton is incorrect? A. The dynamic aspect of cytoskeletal function is made po
    7·1 answer
  • 18 points+brainliest! please i need help with this
    6·1 answer
  • Describe a way in which scientists can determine if a newly discovered object should be classified as living or non-living.
    15·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Why are health authorities concerned when the vaccination rates for an infectious disease fall?
    7·1 answer
  • We can determine the velocity of a wave when given the frequency and the
    8·1 answer
  • If mRNA had the codon GUA, what amino acid does that code for?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!