1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lady bird [3.3K]
3 years ago
6

If forests serve as important sinks for greenhouse gases, describe how past ice ages might have affected the concentration level

s of carbon dioxide in the atmosphere.
Biology
1 answer:
Marina CMI [18]3 years ago
6 0
When the ice melts it releases carbon into the air and form more green house gases
You might be interested in
During which part of pregnancy does the fetus begin to blink its eyes and become more active
Nikolay [14]

The answer is In the last trimester of pregnancy. While the senses of the fetus start to develop in the 8th week, the different sense mature at different stages. Vision is the last sense to mature. After the 26th week, after the eyelids of the fetus have fully developed, the fetus begins to blink (even experience REM while involves rapid eyelid movements ).






6 0
3 years ago
The predator-prey relationship is an example of commensalism.<br> True<br> False
katrin [286]

Answer is False

Predator- prey is example of predation

4 0
2 years ago
Could someone please help me?
stealth61 [152]
Its "changes occur in the organism" answer
6 0
3 years ago
A specific characteristic that varies from one individual to another.
victus00 [196]

Answer:

Intelligence, Height, Weight, and eye-color could all qualify

Explanation:

8 0
3 years ago
Read 2 more answers
How does biodiversity affect ecosystem stability?
-Dominant- [34]
B. biodiversity of an area has a large impact on the ecosystem stability of that area. ... This increase in complexity makes it more likely that the ecosystem will return to a stable state after a disturbance, because the ecosystem has more ways to respond to a disturbance and fix problems.
8 0
2 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Which of the following is an example of an equilibrium theme?
    7·1 answer
  • What do I need to know about understanding what is happening to people with dmd
    5·1 answer
  • Choose the incorrect statement concerning centrioles.
    9·2 answers
  • WHOEVER ANSWER THIS PROBLEM WILL EARN BRAINLIEST!!
    15·2 answers
  • What is apoptosis? plzzz help
    12·2 answers
  • Which best describes the process that occurs when nuclear DNA codes for a protein in the cytoplasm
    13·1 answer
  • PLEASE HELP!!!!! Question 7 of 10
    7·2 answers
  • Which of the following is a clue that a chemical change has taken place?
    8·2 answers
  • Which statement best describes the position of the Sun at sunrise and sunset as seen by an observer in New York State on Decembe
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!