1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Shtirlitz [24]
4 years ago
11

Pls help me! Up votes are at MAX!

Biology
1 answer:
luda_lava [24]4 years ago
4 0
I believe its D. Seeds, I hope this helps
You might be interested in
Where are hydrophobic interactions most likely to occur?
lutik1710 [3]
Hydrophobic effect is the tendency of non polar molecules (hydrophobic) in a solvent that is polar to interact with each other resulting to a hydrophobic interaction. These non polar molecules are called hydrophobes and are made of long chains of carbon that are water hating (do not interact with water). In this case,the hydrophobic interactions are most likely to occur on the core of a water soluble protein. 
6 0
4 years ago
Read 2 more answers
Which law makes you expect to find stratum D in sector 3
ale4655 [162]
The definitions of "sector 3" and "stratum D", the layout of the sectors,
and the behavior of the strata would go a long way toward explaining
that mysterious absence.  
5 0
3 years ago
Which is not a characteristic of living things? Organisms can adapt to changes. Organisms respond to changes. Organisms only nee
tresset_1 [31]

Not a characteristic of living things is organisms only need water.

3 0
3 years ago
Soil formation is most influenced by _____.<br><br> A.climate<br> B.plants<br> C.wind<br> D.animals
Tems11 [23]
A. climate, because temperature and precipitation are directly related to how dry or fertile soil is
6 0
3 years ago
Read 2 more answers
Type of digestion that increases surface area
zubka84 [21]

Answer:

Mechanical digestion

Explanation:

8 0
3 years ago
Other questions:
  • The humanistic perspective emphasized the value of
    12·1 answer
  • Which of these is a process by which water, carbon dioxide, and energy are formed?
    9·2 answers
  • A blood smear is used to diagnose malaria. In patients with malaria, the protozoa can be found near and inside red blood cells.
    10·1 answer
  • 8.In a variety of beans the genes for pod texture and seed color are closely linked on the same chromosome. Tough pods (T) are d
    12·1 answer
  • What is the smallest unit of biological organization that is alive
    7·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Sino gusto pointspointspoints!!!!​
    13·1 answer
  • Please answer this question below:​
    9·1 answer
  • Which of the following is a physical adaptation for the underlined animal?
    14·1 answer
  • Every ecosystem has its own set of environmental stresses. What nonliving factors would cause stress to organisms in a forest ec
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!