1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tatiana [17]
3 years ago
7

Explain what Scientific Adam is and what identifying him means for science and for religion.

Biology
2 answers:
alex41 [277]3 years ago
8 0

Answer: This is talking about Y-chromosomal Adam,or Y-MRCA,which is the most recent common ancestor from whom all currently living males are descended patrilineally.

Explanation:

Most Christians believed that the entire human race actually descended from our literally first parents, Adam and Eve until the advent of Darwinian evolution. This belief has been challenged by modern scientific claims on two front:

1. The belief that true man suddenly appeared in the form of Adam has been replaced with standard theory of human evolution in which progressive changes in early primates evolved the consciouand consciousness intelligence of modern man.

2. The claim that our human species arose from a single pair of first parent has been replaced with evolution taking place in large population whose number never saw a bottleneck or reduced population of just two individuals

Tcecarenko [31]3 years ago
3 0

Answer:

The Scientific Adam refers to the most recent common ancestor of all males, given that some scientists theorize that all currently living men share the same mutations in their Y chromosome, proving that one man fathered all of humanity.

Identifying the Scientific Adam would be very important for both science and religion, as it would provide a bridge between these two often collided fields. The Scientific Adam proves the existence of the biblical Adam.

You might be interested in
Organic molecules usually contain
choli [55]

Answer & Explanation:

An organic molecule is one which contains carbon, although not all compounds that contain carbon are organic molecules. ... Although carbon is present in all organic compounds, other elements such as hydrogen (H), oxygen (O), nitrogen (N), sulfur (S) and phosphorus (P) are also common in these molecules.

4 0
2 years ago
7 is what on a pH scale
HACTEHA [7]

The pH scale measures how basic or acidic a substance is, and it ranges from 0 to 14. On the pH scale, a pH of 7 is neutral, less than 7 is acidic and higher than 7 is basic.

3 0
3 years ago
What percentage of children diagnosed with ocd show complete remission?​
Lunna [17]
The correct answer is A. Hope this helps!

8 0
3 years ago
Read 2 more answers
Assume that the red blood cell counts of women are normally distributed with a mean of 4.577 million cells per microliter and a
postnew [5]

Answer:  C. ​82.26%

Explanation:

Given :  The red blood cell counts of women are normally distributed with

\mu=4.577\text{ million cells per microliter}

\sigma=0.382\text{ million cells per microliter}

Let X be the random variable that represents the red blood cell counts of randomly selected woman.

Z-score : z=\dfrac{X-\mu}{\sigma}

For X=4.2

z=\dfrac{4.2-4.577}{0.382}\approx-0.99

For X=5.4

z=\dfrac{5.4-4.577}{0.382}\approx2.1544

Now, the probability that the women have red blood cell counts in the normal range from 4.2 to 5.4 million cells per​ microliter will be :-

P(4.2

Hence, 82.26% of women have red blood cell counts in the normal range from 4.2 to 5.4 million cells per​ microliter.

4 0
3 years ago
What are differences between sperm and egg?
Firlakuza [10]
Sperm cells come from the male
egg cells come from the female
5 0
3 years ago
Other questions:
  • Sexual reproduction is important to the survival of a species in a changing environment because
    8·1 answer
  • Select the five cellular organelles that are part of the endomembrane system.
    10·1 answer
  • What helps identify cell types?
    7·1 answer
  • Si se rompe un utensilio de cristal en un laboratorio, cómo se recoge?
    15·1 answer
  • Read the paragraph.
    8·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Suppose you throw a cube-shaped object and a spherical-shaped object of equal volume in the same volume of water. The ball sinks
    7·1 answer
  • The genetic code is defined degenerate or even redundant because:
    12·1 answer
  • Match the word to the best sentence.
    10·1 answer
  • Which of the following best describes the contributions of Robert Remak to our understanding of cells?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!