1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Orlov [11]
3 years ago
12

2. When a plant undergoes photosynthesis, one of the by-products is

Biology
1 answer:
pshichka [43]3 years ago
7 0
<span>When a plant undergoes photosynthesis, one of the by-products is oxygen or CO2.

Hope this helps !!! ^_^ !!!</span>
You might be interested in
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
2 years ago
Producers like this plant take in oxygen and releases carbon dioxide during​
Monica [59]

Answer:

plants take in oxygen and release carbondioxide during respiration

Explanation:

7 0
2 years ago
Animals that reproduce sexually differ from animals that reproduce asexually in that sexually reproducing animals have
Black_prince [1.1K]

Answer:

a) more genetic variation among their offspring

Explanation:

6 0
3 years ago
The what are located on either side of the uterus and serve passage way to the uterus
Juli2301 [7.4K]
Answer: <span>fallopian tubes

The fallopian tubes are two narrow tubes located on either side of the uterus that are involved in transporting the female egg from the ovaries to the uterus.</span>
3 0
3 years ago
In the visual system, the major purpose of the iris of the eye is to
Irina18 [472]

The major purpose of the iris in the eye in terms of the visual system is focusing the light on the retina as the iris is responsible of managing the light passing or reaching in the retina of the eyes.

5 0
2 years ago
Other questions:
  • If you want to selectively label RNA being synthesized by cells(and not DNA) what radioactive compound would you add to the medi
    14·1 answer
  • You are trying to determine information about the structure of a protein that you have purified. You carry out a series of exper
    11·1 answer
  • The part of the livestock female reproductive system that is between the infundibulum and the uterus and is also called the fall
    14·1 answer
  • Which mutation will cause translation to stop?
    9·1 answer
  • Aida was reviewing what she learned about peer-reviewed work. She recreated the diagram.
    7·2 answers
  • What is modern genetic techniques?
    10·1 answer
  • Suppose that a cytoplasmic protein (a protein that will function in the cytoplasm inside of the cell) is synthesized by a partic
    8·1 answer
  • True or False. The source of all clouds and precipitation is water vapor.
    12·1 answer
  • Please answer number 4! It’s a do-now!
    13·1 answer
  • Which of the following are examples of genetic drift?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!