1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Minchanka [31]
3 years ago
8

Which includes all the others? zoologist biologist paleontologist or botanist

Biology
2 answers:
vlada-n [284]3 years ago
7 0

Palaeontologists, zoologists and botanists are all biologists that specified in natural history, animal life and plant life respectively.

Biology is also part of a bigger field of natural science which in turn forms part of a bigger, major field of study, called science.


Hope it helped,


BioTeacher101

liq [111]3 years ago
4 0

paleontologist, zoology for the type of dinorsaur, biology for the makeup for testing, and botanist to identify what kind of plants and stuff

You might be interested in
(04.01 LC) Proteins, carbohydrates, and lipids are examples of biological ____________. molecules nucleic acids particles cells
ollegr [7]
The answer, I think, is molecules.

Hope I could help!
5 0
4 years ago
Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
Tomtit [17]

Answer:

I'll break this into threes so its easier to read;

TTC ATG CTA GCT ACG TGT ACG TAC CGA TGC G

Explanation:

In DNA, the A bases goes with the T bases, and the C bases go with the G bases.

3 0
3 years ago
What has to be true for substrate-level phosphorylation to occur?
natima [27]
Well one it is true cuz it is true but ya your right ok
3 0
3 years ago
How are ocean ridges and trenches related? Describe their relationship in
True [87]

Terms that are asked to be used in the response are bolded;

     Ocean ridges and trenches are related in a few ways. One of the ways is being created from the movement of tectonic plates on the mantle when they diverge and converge. When tectonic plates diverge they "pull apart" and create trenches. When they converge they "push together" and create ridges, subduction happens here. The tectonic plates move on the mantle of magna from convection currents creating these different boundaries.

Have a nice day!

<em>Note: Please keep in mind that if you would like to use my work you must reword it or give a proper citation, thanks.</em>

     I hope this is what you are looking for, but if not - comment! I will edit and update my answer accordingly.

- Heather

8 0
2 years ago
WILL GIVE A BRAINLEST
Sedaia [141]
Hey there!

The answer is D. Protect the fields from floods. 

Hope this helped!! ☺♥
8 0
3 years ago
Other questions:
  • Is a cyst filled with a milky fluid containing sperm that develops in the epididymis?
    9·1 answer
  • What are some ways that the nitrogen cycle overlaps with or influences the oxygen and carbon cycles?
    7·1 answer
  • True or false? ectopic pregnancies are never viable and must be surgically removed.
    5·2 answers
  • Which statement about solar eclipses is false?
    6·2 answers
  • According to the food pyramid which level has the greatest amount of energy?
    15·1 answer
  • The main difference between stream pools and ponds is that stream pools _______.
    6·2 answers
  • RNA is believed to be a more primitive molecule than DNA because
    9·1 answer
  • To prepare for an experiment, ten different sources of food were sterilized and kept in a sterile container. Bacteria of the sam
    12·1 answer
  • What molecule or gas is not necessary for plants and is then released?
    10·1 answer
  • Only summarize section pls due I’ll give brainliest and 25 point please help
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!