What continents lie mostly north of the equator

2 answers:

3 0

North America and Europe lie entirely north of the equator. Almost all of Asia, most of Africa, and a part of South America are above the equator. Not sure if South America counts as 'mostly' though. That's up to you.

kvv77 [185]3 years ago

3 0

North America, Asia, Europe, and Africa

You might be interested in

The organism shown is a free-living one that is anchored to the bottom of ponds and streams during the first part of its life cy

luda_lava [24]

The common name of this organism is hydra.

Explanation:

Hydra is a fresh water organism and belongs to the phylum Cnidarian. They have tentacles around their body that enables locomotion as well as protection from prey. Hydra has the ability of regeneration and the asexual mode of reproduction in hydra is budding.

In the budding process, a small bud develops in the parent body and the bud after maturation gets detached from the parent body and grows into a new individual. Sexual mode of reproduction is also found in hydra.

5 0

3 years ago

Read 2 more answers

All living things are made of ________ like carbon, nitrogen, and oxygen

MrRissso [65]

Answer:

Water

Explanation: I think this is the answer if I am wrong please tell me thank you.

3 0

3 years ago

The total number of organisms an ecosystem can support is its tolerance range. True or false

Monica [59]

Answer;

The above statement is false

The total number of organisms an ecosystem can support is its carrying capacity.

Explanation;

-Carrying capacity is the average population density or population size of a species below which its numbers tend to increase and above which its numbers tend to decrease because of shortages of resources.

-For a given region, carrying capacity is the maximum number of individuals of a given species that an area's resources can sustain indefinitely without significantly depleting or degrading those resources.

The carrying capacity is different for each species. in a habitat because of that species’ particular food, shelter, and social requirements.

6 0

3 years ago

Read 2 more answers

I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran

Anarel [89]

Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.

4 0

3 years ago

A cell that contains organelles called chloroplasts

kupik [55]

Explanation:

A cell that contains organelles called Chloroplasts could be found in plants. 

Chloroplasts are organelles that conduct photosynthesis, where the chlorophyll(green pigments found in plant) captures the energy from sunlight, converts it, and stores it.A chloroplast is a type of organelle known as a plastid. 

4 0

3 years ago