1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natalija [7]
3 years ago
6

1. What did Darwin’s research on the Galapagos Islands show?

Biology
2 answers:
baherus [9]3 years ago
8 0

Answer:

Darwin's research on Galapagos Island put forward his theory of natural selection.

Explanation:

Iteru [2.4K]3 years ago
4 0

Answer:

Darwin's research on Galapagos Island put forward his theory of natural selection.

Explanation:

1. Charles Darwin studied the similarities of the finches between the various islands of Galapagos. His study noted that the finches were similar from island to island making him to wonder about the origin of this species as these perfectly adapted to their environment. His compilation of observation about the finches, the fastest evolving vertebrates, described its behavior and appearances which changed according to the changing environment., thus making them to adapt quickly. These were further converted for his book 'The Origin of Species' that changed the concept of evolution.

2. Grants research on Galapagos Islands were conducted by Peter Raymond Grant and Barbara Rosemary Grant, both evolutionary biologists. Their work focussed on the Darwin's finches through processing of collecting blood samples and tagging them. They were able to indicate that changes within the species is evident within a single lifetime. Their study indicted that changes in populations takes place quickly and need not wait for long time as indicated in Darwin's theory.

3. The Galapagos Island is a ground to more species that have risen due to adaptation. Due to its remote location, it was possible for the scientists to conduct study about natural selection on biodiversity. THere are 18 species that have evolved from Darwin's finches.  The diversification observed in the finches were the shape and size of beaks.

The Darwin's finches developed over time with strong crushing and probing  beaks adapted to catch insects or crack nuts. Even some have sharp long beaks to drink blood.

Another species observed is the marine Iguana with adapted short blunt stout, and long tail to swim deep into sea.

The flightless cormorant found in this island, were adapted to survive as there was no necessity to fly. Instead their dense bodies, small feet, and powerful legs makes them to be good divers to hunt fish, eels, and small octopus.

You might be interested in
What are the two main categories that all water can be classified into?
poizon [28]

taper watwe mineral water

4 0
3 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Arrange the following to smallest to biggest
OverLord2011 [107]

Answer:

Human, nervous system, nerve tissue, neurons.

Explanation:

The organism is the biggest, in this case is a human, a human is composed of systems, and then organ tissue, and organ tissue is made out of cells.

4 0
3 years ago
Read 2 more answers
What do humans need from the nitrogen and phosphorus cycle
otez555 [7]
It’s essential for the creation of DNA, cell membranes, and for bone formation in humans. It is also vital for food production.
6 0
3 years ago
Read 2 more answers
Can I get images of thoracic cavity with define​
mart [117]

Answer:

Thoracic cavity, also called chest cavity, the second largest hollow space of the body. It is enclosed by the ribs, the vertebral column, and the sternum, or breastbone, and is separated from the abdominal cavity (the body's largest hollow space) by a muscular and membranous partition, the diaphragm.

<h3>For further details and images:</h3>

  • https://www.google.com/search?q=thoracic+cavity&client=ms-android-sanmu&prmd=ibnv&source=lnms&tbm=isch&sa=X&ved=2ahUKEwii__unmPTnAhWFyzgGHfGvAAsQ_AUoAXoECAwQAQ&biw=397&bih=549#

  • https://www.google.com/search?q=thoracic+cavity&client=ms-android-sanmu&prmd=ibnv&source=lnms&tbm=isch&sa=X&ved=2ahUKEwii__unmPTnAhWFyzgGHfGvAAsQ_AUoAXoECAwQAQ&biw=397&bih=549#&biw=397&bih=549

<h2>HOPE U UNDERSTOOD</h2><h2>Please MARK as brainliest</h2>

4 0
3 years ago
Other questions:
  • Which of the following would most likely be treated with antibiotics?
    12·2 answers
  • WILL GIVE A BRAINLEST AND 20PTS
    8·2 answers
  • True or False. The arrow labeled A represents a transfer of solar energy to chemical energy.
    11·1 answer
  • As a result of the absence of plants in the meadow,the rabbit population will probably
    14·1 answer
  • Nutrient databases can be used to determine
    14·1 answer
  • 5 types of trees quick PLEASE
    13·2 answers
  • Dr. Fatima was investigating the pathways in photosynthesis. She observed a set of chemical reactions whereby electrons were get
    8·1 answer
  • Which statement most accurately describes human skeletal muscle
    7·1 answer
  • 2. What structure caused rotifers to be called wheel animals or wheel bearers?
    8·1 answer
  • . certain varieties of chrysanthemums contain 18, 36, 54, 72, and 90 chromosomes; all are multiples of a basic set of nine chrom
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!