1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Harlamova29_29 [7]
3 years ago
8

The greenhouse effect may increase on Earth because

Biology
1 answer:
JulsSmile [24]3 years ago
5 0
Burning fossil fuels like coal and oil puts more carbon dioxide into our atmosphere. NASA has observed increases in the amount of carbon dioxide and some other greenhouse gases in our atmosphere. Too much of these greenhouse gases can cause Earth's atmosphere to trap more and more heat. This causes Earth to warm up.
You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Dan made the table shown to describe two different relationships between animals.
kompoz [17]
I believe the answer is commensalistic because it wouldnt be parasitic because the other isnt getting harm and its not mutual because both aren’t benefitting from it
4 0
3 years ago
Quiz
ser-zykov [4K]

Answer:

Explanation:

bruh

4 0
3 years ago
Gene __________ is a term used to refer to the fact that the environmental experiences that one has throughout his or her develo
agasfer [191]
Gene regulation is the answer
4 0
3 years ago
Where do many of the plants in the phylum polypodiophyta live?
Dimas [21]

The correct answer to this question is forests.

8 0
3 years ago
Read 2 more answers
Other questions:
  • Hiiii people...I need help plsss and thx:)
    8·2 answers
  • A plant that does not have veins in its leaves or stems has rhizoids that help absorb water, and it also has a spongy appearance
    9·2 answers
  • Decay
    14·2 answers
  • What is natural gas?
    11·2 answers
  • An important function of the hypothalamus is:
    13·2 answers
  • Which structure would be most beneficial for a plant in a tundra biome? A. shallow roots that do not reach the frozen soil B. de
    12·1 answer
  • 7. What is the relationship between the amount of greenhouse gasses in the atmosphere and the average global temperature
    13·1 answer
  • Darwin's next insight was to compare process in nature to artificial selection. By doing so, he developed a scientific hypothesi
    5·1 answer
  • You have recently identified a new toxin. It is produced by a gram-negative bacterium. It is composed mostly of protein, has hig
    8·1 answer
  • Write which organism from the images fits each of the following descriptions.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!