PLEASE HELP ME!!!!!!!

Biology

1 answer:

3241004551 [841]3 years ago

8 0

Answer:

Explanation:

Without the presence of decomposers and detritivores in a forest ecosystem organic material would not break down and the nutrients would no longer be available to other organisms. Moreover, dead plants and animals will pile up. Because, detritivores eat fragments of dead matter in an ecosystem and decomposers break down dead organisms so the environment will no longer be clean.

You might be interested in

Help with the top right please

MatroZZZ [7]

O2 is a Gas , we aspire it from the air

5 0

4 years ago

Contaminated soil can be rehabilitated by physical remediation methods, like aeration. What is another way soil can be treated t

Ivanshal [37]

Answer:

C) Flush out the contaminants with an excessive amount of water.

Explanation:

Water is universal solvent. It dissolve many solutes inside it. Soil is contaminated with number of chemicals which is used by farmers for the controlling of pathogens. These chemicals remains on the soil for very long time. These chemicals are removed from the soil by applying high amount of water which flush out the chemicals from the soil.

4 0

3 years ago

Read 2 more answers

Whats the word for a large number of species in an ecosytem?

luda_lava [24]

A biodiversity
Hope this helps

6 0

3 years ago

1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?