1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lapatulllka [165]
3 years ago
12

What do scientists call information collected from observations?

Biology
2 answers:
geniusboy [140]3 years ago
5 0
Data is what you collect
Marat540 [252]3 years ago
4 0
What information is collected from a hypothesis and also when they test a hypothesis is also known as collecting data.
You might be interested in
What the bone marrow
Oduvanchick [21]
Bone Marrow is tissue in the hollow centers of our bones, it has stem cells which produce our blood cells. It also produces red blood cells that give oxygen to the whole body. Hope this helped : )
8 0
4 years ago
Read 2 more answers
Which of the following is NOT a characteristic of minerals?
ddd [48]
Definite chemical composition
3 0
3 years ago
Read 2 more answers
Design an imaginary food web or describe a real one. Include at least 4 living organisms that interact in your ecosystem.
PtichkaEL [24]

The trophic web is the interaction between different organisms in which there is energy transference. In the attached example, we consider plants, beetle, rabbit, frog, eagle, fox, mountainlion, and fungi.

<h3>What is the trophic web?</h3>

The trophic web is the interaction between different organisms involving transference of energy when some of them feed on the other ones.

The ones placed at lower levels pass energy to the ones at the higher levels.

Organisms at each level feed on the preceding one and become food for the next one.

• The first link corresponds to a producer organism -autotroph-.

• The following links are the consumers -heterotrophs- ⇒ herbivores and carnivores.

• The last links are the decomposers that degrade organic matter from dead organisms.

Because it is a web, all organisms are in equilibrium until a change occurs. When a sudden change affects any of the involved links, there can be a cascade effect on the web.

Any change in a link population size (increasing or decreasing) will affect the superior links and the immediately anterior link.

Example.

To make the trophic web, first, we need to have at least four links.

So first, let us list the organisms we are working with, and then define the position of each of the organisms on the web.

  • plants,
  • beetle,
  • rabbit,
  • frog,
  • fox,
  • mountain lion,
  • eagle,
  • Fungi

<u>Producer</u> → this is the autotroph organism that takes energy from the sun or any other inorganic source → An example of this is any plant.

<u>Consumers</u> → heterotroph

⇒ Herbivores → These are the animals that feed on any part of the plants → These are the beetle and the rabbit

⇒ Carnivores → These are the animals that feed on herbivores → These are the frog, the fox, the eagle, and the mountain lion

<u>Decomposer</u> → detritivorous organisms that take energy from dead matter → Fungi

Trophic web,

  • Plants directly provide energy to the beetle and the rabbit

Plant >> Beetle and Rabbit

  • The eagle takes energy from the rabbit and the frog takes energy from the beetle.

Rabbit >> Eagle

Beetle >> Frog

  • The fox takes energy from the frog and from the rabbit

Frog and rabbit >> Fox

  • The Fox and the eagle transmit energy to the mountain lion.

Fox and Eagle >> Mountain lion

  • Fungi takes energy from dead organic matter

Plants, beetle, Rabbit, Fox, Eagle, Mountain lion >> Fungi

You will find an image in the attached files.

You can learn more about the trophic web at

brainly.com/question/8354950

#SPJ1

5 0
2 years ago
The percentage of U.S. buildings that suffer from poor indoor air quality is about percent
saveliy_v [14]
Its about 30 percent. :)
3 0
3 years ago
What property of carbon makes it essential for organic life?
zubka84 [21]

Answer: Carbon is one of the most important chemical, non-metallic element that is considered to be the fundamental unit, making up the organic life. Carbon is present in almost all the living beings existing on earth.

Carbon plays a significant role in the carbon cycle. It transfers from plants to the animals or organisms as one consumes the plants, vegetables that are around us and further released into the atmosphere from the bodies of the living creatures during exhalation. This continuous transformation of carbon from one place to another is regarded as the carbon cycle.

It is abundant and can easily react with various elements.

6 0
3 years ago
Other questions:
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • How do urea and mercaptoethanol effect ribonuclease?
    15·1 answer
  • Which are ways of showing probability? Select 4 options.
    11·2 answers
  • The __________ is the complex organ that enables people to complete many actions and processes.
    5·2 answers
  • From your knowledge about the distribution of electrons in their shells and from the atomic number (in parentheses), indicate th
    7·2 answers
  • What type of particles pass through diffusion
    7·1 answer
  • Gray matter on the surface of the brain is/are called
    15·2 answers
  • Which of the following are products in the process of cellular respiration?
    15·1 answer
  • Neurons are activated by which of the following?
    6·2 answers
  • Can someone help me pls.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!