1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andrew [12]
3 years ago
13

Carbohydrate molecules have all of the following bonds except-

Biology
1 answer:
LenKa [72]3 years ago
4 0
The correct option is B.
Carbohydrates are made up of three different elements which are carbon, hydrogen and oxygen. In the carbohydrate molecules, these elements are connected in various way forming C-C, C-H AND C-O bond. C-N bond does not exist in carbohydrates because carbohydrates do not contain nitrogen.
<span />
You might be interested in
The diagram below shows a certain method of grazing animals
WITCHER [35]

Answer:

In agriculture, rotational grazing, as opposed to continuous grazing, describes many systems of pasturing, whereby livestock are moved to portions of the pasture, called paddocks, while the other portions rest.

Explanation:

hehe ....

5 0
2 years ago
Read 2 more answers
Which molecules stores the energy that is produced during cellular respiration?
Sergio039 [100]

the answer is A.H2O

4 0
3 years ago
what will happen if one of the levels in the biological organization will not perform its function properly?​
Sedaia [141]

Answer:

It would affect the functionality of the other levels including the organism

Explanation:

The level of biological organization is a hierarchical step consisting of how a multicellular organism forms. According to this level of organization, CELLS are the simplest unit of life and the collection of cells with a similar function is termed TISSUE. Tissues form ORGANS, organs form ORGAN SYSTEMS and finally, a collection of all the systems in the body forms the ORGANISM.

Based on this, one would observe that each level is related to the next in such a way that one forms from the other. Hence, if one of the levels in the biological organization will not perform its function properly, the other levels will be affected. For example, if the kidney cells do not perform it's function, it would affect the functionality of the kidney tissues, kidney organ, the excretory system, and the organism at large.

7 0
3 years ago
Another name for a fertilized egg is a
oee [108]

Answer: The fertilized ovum, now called a zygote, is ready for the first mitotic cell division.

4 0
2 years ago
Write one function of each of the following enymes<br>1) Pepsin( 2) Lipase​
ludmilkaskok [199]

Answer:

the pepsin produces pepsinogen and the pepsinogen also peptides

4 0
2 years ago
Other questions:
  • Describe volcanic-atmosphere hypothesis
    14·1 answer
  • Order the taxa from largest (first) to smallest (fifth). 1. first domain 2. second order 3. third kingdom 4. fourth class 5. fif
    10·2 answers
  • Classifying animals as endangered or threatened: select one:
    14·1 answer
  • UCP1 expression is increased specifically in adipose tissue. During glucagon signaling in adipose, what would be the fuel source
    14·1 answer
  • The seasoned nurse is instructing the new graduate on information obtained from central venous pressure and pulmonary artery pre
    12·1 answer
  • How does the ocean floor keep track of magnetic fields?
    13·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which type of phagocytic disorder (formerly known as Job syndrome) occurs when white blood cells cannot initiate an inflammatory
    6·1 answer
  • The highest level in the organizational hierarchy of the human body is the ________.
    14·2 answers
  • After throwing a basketball through the net, Anna observed the ball as it hit the
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!