1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hoa [83]
3 years ago
9

Which organ does the most of the processing of nutrients in the human body?

Biology
1 answer:
Andre45 [30]3 years ago
3 0

The <u>small intestines</u> perform the majority of nutrient absorption in the human body.

You might be interested in
what is a mass extinction? what is a mass extinction? an event that causes the extinction of a large fraction of earth's species
sineoko [7]

A mass extinction event occurs when a species disappears far more quickly than it is replaced. This is typically understood as the loss of around 75% of all species over a "short" period of geological time, or fewer than 2.8 million years.

An enormous number of species were wiped out by a harsh, worldwide, swift, and selective event is mass extinction. According to marine fossils, at least 75% of all species are thought to have become extinct. The most recent mass extinction is the Cretaceous-Paleogene extinction event, which is also the only one that can be proven to have been caused by a significant asteroid impact. All non-avian dinosaur species, making up about 76 percent of all species on the earth, perished during mass extinction. The Chicxulub asteroid impact in what is now Mexico, which occurred 66 million years ago, caused an ecosystem collapse that resulted in the extinction of the dinosaurs and >75% of all land and sea species as well as the macroevolution of mammals.

Learn more about mass extinction

brainly.com/question/11872946

#SPJ4

8 0
1 year ago
Pls help!
AysviL [449]

Answer:

i think is Destruction of coral

5 0
2 years ago
Read 2 more answers
What environmental worldview is seen by critics as focused on short-term economic benefits with little regard for long term harm
attashe74 [19]
I believe the answer is the global free-market approach.
It is because on continually increasing use of earth's natural capital, and it focuses on short term economic benefits with little regard for degradation and depletion of natural capital and resulting long-term harmful environmental, health, and social consequences. Environmental world views are the ways of thinking about how the world work and beliefs that people hold about their roles in the natural world, another factor is widespread lack of understanding of how earth's life-support system works, keeps us alive, and supports economies. 
6 0
3 years ago
Anyone free to talk with mel​
Ipatiy [6.2K]
I ammmm ! i’ve been up all night i can’t sleep at all.
8 0
3 years ago
As part of a purification technique, a mixture of small-protein hormones and peptides are placed in a gel and exposed to an elec
lidiya [134]

Answer:

The correct answer is "negative".

Explanation:

At pH 2 the net charge of the R groups of all the amino acids that comprise the peptide in question would be positive. This happens because of the high content of protons in a solution of pH 2, a value that is below the isoelectric point of all the amino acids. Since the peptide would have a positive net charge, it would migrate to the negative terminal of the gel because opposite charges attract each other.

7 0
3 years ago
Other questions:
  • Are Endocytosis and exocytosis are types of vesicle transport
    6·1 answer
  • What are some of the main features found on the Sun’s surface. Describe these features in detail.
    5·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • DNA is described as a double helix or a twisted ladder?
    14·2 answers
  • What materials are transported in a plant
    14·1 answer
  • All pros when conducting a lab experiment except?
    6·1 answer
  • The process of the Rock Cycle
    6·2 answers
  • ASAP WILL GIVE BRAINLIEST
    10·1 answer
  • Plzzzzzz i need help it’s due soon!
    13·1 answer
  • Briefly describe ANY environmental condition that affects photosynthesis.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!