1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleonysh [2.5K]
3 years ago
10

Biology ecology unit review protect

Biology
1 answer:
Dmitry_Shevchenko [17]3 years ago
3 0

Answer:

Ecology is the study of environment and biology is study of plant and animals.The interrelationship between an organism and environment

Explanation:

Ecology is the study of organisms, its distribution, abundance,interrelationship with another organism and the interaction of organisms with their environment in which they adapt to survive.

Sunlight is the main source of energy for living beings on earth. Movement of energy flow and nutrient cycle plays a significant role in living beings.

In ecology there are different levels of organization such as species,  population community,ecosystem,biome and biosphere.

There are different cycles which an organism required to survive, carbon cycle, nitrogen cycle, oxygen cycle, phosphorous cycle, and of course the most basic thing to survive is the water cycle. All these cycles coming under one term called the biogeochemical cycle.

The ecological pyramids such as pyramids of an ecosystem, pyramids of number pyramids of energy flow and pyramids of biomass based on these pyramids living things survive.

You might be interested in
predict the shape of a population growth curve for a game park in which a male and female rhinoceros are released
FromTheMoon [43]
Nearly flat. Rhinos don't really reproduce rapidly.
7 0
3 years ago
PLS HELP! NEED THREE SENTENCES!
stellarik [79]

Answer:

The pain nerves in her hand go to the brain to notify it. The brain processes this information and decides to tell the hand to remove itself from the stove. Then, the brain sends this signal back to the hand to make it remove tself from the stove.

Explanation:

3 0
3 years ago
Explain what takes place in each step of the diagram
Andrei [34K]

The given image is showing the interaction of the enzyme and its substrate.

In the first part of the image, the enzyme and substrate are not bind together. They are present in close proximity. The enzyme shown in the picture have a site for the attachment of the substrates.

In the next picture, the interaction of the enzyme and the substrate has occurred, which resulted in the formation of the enzyme substrate complex. Hence, the given picture shows the interaction of an enzyme with the substrates.

3 0
2 years ago
Please help!!!
BabaBlast [244]

Answer:

mother's

Explanation:

3 0
2 years ago
Which of the following characteristics do most amphibians share?
insens350 [35]

Answer:

`B

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • Can you please help me with my homework I need responses for this survey I did and I can really appreciate the help, since i hav
    5·2 answers
  • What is an organ made of?
    10·2 answers
  • Meiosis starts with ___# of cells and ends with__ # of cells
    6·1 answer
  • Which statement describes the term "heterozygous"? A) The alleles are the same. B) The alleles are different. C) There is no all
    15·1 answer
  • Which of these doctors is most likely to perform a skin test?
    7·2 answers
  • In what order do these three organ systems of the human body operate during a reflex arc in response to a stimulus of sharp pain
    5·1 answer
  • Scientists from which nations were involved in discovering and describing the strong nuclear force?
    11·2 answers
  • A rolling ball travels 7.3m in 3.7s. What was the velocity of the ball?
    6·1 answer
  • if a sample contains 20g of an isotope that has a half life of 1000 years how much will be left after 2000 years
    8·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!