1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maks197457 [2]
3 years ago
11

Why does geographic isolation cause speciation?

Biology
2 answers:
zimovet [89]3 years ago
3 0

Answer:

A. It allows two populations to evolve separately.

Explanation:

Geographic isolation is theorized to have catalyzed the formation of new species. Let’s say groups A and B of a bird species get separated by something, and they can’t cross between to interbreed or exchange alleles.

We describe this as no gene flow, which is the opposite of choices C and D. Because of this, they may diverge if given enough time due to the difference in environmental pressures, because they’re now in different environments.

B is incorrect because it doesn’t apply.

Alex_Xolod [135]3 years ago
3 0
A. Is correct. It allows two populations to evolve separately
You might be interested in
Which of the following provide evidence that South America, Africa, Antarctica, and Australia were once together as one supercon
Sergeu [11.5K]

Mountain chains match up where South America collided with Australia to form Pangaea.

4 0
3 years ago
Read 2 more answers
Definition of ecology​
zubka84 [21]

Answer:

The scientific study of interactions among organisms and their environment.

Explanation:

8 0
3 years ago
3. What does the name protozoa mean?
zubka84 [21]
a group of single-celled eukaryotes.
6 0
2 years ago
Changes in the DNA sequence or mutations help drive
Jobisdone [24]
Changes in the DNA sequence, or mutations, help drive evolutionary change
7 0
3 years ago
Every living cell, DNA and RNA serve as the molecules that store and transmit genetic
garri49 [273]

Answer:

Nucleic acids

Explanation:

Nucleic acids are one of the four biomolecules found in living systems ( the other three being carbohydrate, protein, lipids). Nucleic acids, like every other polymer molecule, are made up of monomeric units called NUCLEOTIDES.

The two nucleic acids are Deoxyribonucleic acid (DNA) and Ribonucleic acid (RNA) responsible for the storage and transmission of genetic information throughout the cell.

5 0
3 years ago
Other questions:
  • Which layer of the skin is exposed to the environment?
    7·1 answer
  • The frequency of an allele in a population of manatees is 0.15. If the population is at Hardy-Weinberg for this locus, what numb
    15·1 answer
  • Where is the genetic material for all living organisms located?
    12·2 answers
  • since the DNA is the most stable, then why is it easily damaged by ultraviolet rays whereas RNA is not readily damaged by ultrav
    5·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • My dog has been starting to grow this weird fuzzy white fur on her legs. I will be taking her to the grooming and hair cut salon
    5·2 answers
  • Please help Most ovens we use at home are powered by electricity or natural gas. These ovens use fossil fuels. Describe why the
    13·2 answers
  • Who can help me with the question
    9·1 answer
  • Question 9
    8·1 answer
  • .The "ring of fire" refers to:
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!