Why did the Japanese build an empire in Asia?

1 answer:

3 0

In World War I, Japan entered on the side of the Allied Powers and picked off Germany's colonial empire in the Pacific Ocean.

This was probably the high-water mark of Japan's acceptance by the Western powers prior to 1945.

And to this point, Japan had really acted exactly as the various European colonial powers had.

You might be interested in

Name the river that forms a boundery between mexico and the united states

lawyer [7]

It would be the Rio Grande

4 0

2 years ago

What is the tallest vocano in the world at 27° 6'34.6"S and 68° 32'32.1" W?

liraira [26]

Answer: Nevado Ojos del Salado

Explanation:

4 0

2 years ago

How does the Chinese government enforce the "One Child Policy"?

vekshin1

Answer:In China the one child policy was used to limit the growth in the county. This law was enforced by fines based off of the family's income.

Explanation:

7 0

2 years ago

Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA

Rina8888 [55]

Answer:

Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0

3 years ago

What does Hippocrates' theories and the Hippocratic Corpus tell us about the general characteristics of and thought concerning m

ser-zykov [4K]

Fjfnfjrbrbfhrjrbdkelebehrurbkdrktbthrhjejenrhrjrirjrbrjrjekekrkrjrbjrrirokekerhrbrjrjj

5 0

3 years ago