1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Helen [10]
3 years ago
13

In which organism is ddt least concentrated?

Biology
1 answer:
MrMuchimi3 years ago
4 0

Answer: I would say D)

Explanation:Phytoplankton are the autotrophic components of the plankton community and a key part of oceans, seas and freshwater basin ecosystems. This is the least ddt and is concentrated.

You might be interested in
Select all of the answers that apply. If global warming were to raise temperatures 1.5°C to 4.5°C, what would most-likely happen
Lyrx [107]
Polar ice caps would melt and increase the sea level. The ozone layer would be depleted. And hurricanes are also related.

Hope it helped!
7 0
3 years ago
Read 2 more answers
Faking an exaggeration injuries are a natural part of sports True or False ?‍♀️
GenaCL600 [577]
The answer is false i believe

3 0
3 years ago
Read 2 more answers
the process that uses carbon dioxide but not light energy to make sugars is called _____.  a. hydrolysis  b. chemosynthesis 
Lyrx [107]

Answer:

D. respiration

Explanation:

It is basically a process that takes place in the cells of organisms. It converts chemical energy from oxygen molecules or even nutrients into ATP.

Hope this helped!

8 0
3 years ago
Read 2 more answers
What are the locomotory organs of fish?​
spin [16.1K]

Answer:

The tail and the caudal fin are the chief locomotory organs of fish and are used for rapid swimming during which tail is lashed from side to side by "alternate contraction and relaxation" of the myomeres on the two sides of the vertebral column.

Explanation:

4 0
3 years ago
Vision and visual perception occur in the __________ lobe.
Tju [1.3M]
The answer is the occipital lobe of the brain
6 0
3 years ago
Other questions:
  • List three effects mutations can have on genes
    9·1 answer
  • Eating a small serving of a food that is very acidic might present something of a paradox to your stomach because
    15·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Why do offspring from the same parents usually have a different set of traits
    7·1 answer
  • . A failure of the red-sensitive nerves in the eye to respond to light properly causes
    14·2 answers
  • Farmers plough the remains of their crops into the soil e why this is better than burning them
    11·1 answer
  • Explain the term colony as it relates to the bacterial growth on solid media​
    12·1 answer
  • In which of the following conditions are intracellular concentrations of ATP likely to increase?
    13·1 answer
  • HELP!!
    14·1 answer
  • A female has a brother who is color blind and a mother who is not.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!