1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ann [662]
3 years ago
5

53:52

Biology
1 answer:
Valentin [98]3 years ago
5 0

Answer:

A. hydrogen atoms, heat, and pressure

Explanation:

You might be interested in
In which of the following ways are bacteria similar to birds
pentagon [3]

Answer:

They both use DNA as their genetic material.

Explanation:

Bacteria are simple prokaryotic organisms which lack membrane bound organelles. On the other hand, birds like higher organisms are eukarotyotic organisms with proper membrane bound organelles. Other than this that both bacteria and birds are living organisms,  one way in which bacteria and birds are similar is that they both have DNA as genetic material which they pass to their offspring. Although in the case of bacteria there is no variation is offspring however in case of birds there can be because genetic shuffling takes place and offspring is not an exact replica of parents while in case of bacteria they are.

Hope it helps!

3 0
3 years ago
The increasing trend of sexual assault and violence strongly influences the growth of the number of nurses involved in both fore
Pie

Answer:

Forensic nursing involved psychological use of mind to treat one's problem.

Sexual assault and violence are problems 80% treated spiritually cause one's mind maybe damaged due to fear.

5 0
3 years ago
Read 2 more answers
When a protein denatures, which type of bonding is effected?
GenaCL600 [577]

Answer:

When a protein is denatured, secondary and tertiary structures are altered but the peptide bonds of the primary structure between the amino acids are left intact. Since all structural levels of the protein determine its function, the protein can no longer perform its function once it has been denatured.A protein becomes denatured when its normal shape gets deformed because some of the hydrogen bonds are broken. Weak hydrogen bonds break when too much heat is applied or when they are exposed to an acid (like citric acid from lemon juice).

3 0
2 years ago
Aswapati prayed ___for a child.
sergeinik [125]

Answer:

King Aswapati humbly requested for a son. But Deity Savitri ... Later, King Aswapati begot a child. .... She kept her husband's head on her lap and prayed Yama.

Explanation:

this all i got hope this help let me know if this help

3 0
3 years ago
Which would result in higher food production at a lower cost? Check all that apply.
Korolek [52]

Answer:

A, C, D, and E.

6 0
3 years ago
Read 2 more answers
Other questions:
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What is the scientific term for how rocks from magma? 1. Gabbro 2. Intrusive 3. Lava 4. Extrusive
    14·1 answer
  • `What is 10% rule.What is its significance?Why is energy lost?
    6·1 answer
  • A first aider who breaks his or her responsibility to a victim by failing to provide the type of care that another person with s
    12·1 answer
  • Oleander (Nerium oleander) is a common but poisonous ornamental shrub. All parts of the plant contain chemicals that inhibit the
    8·1 answer
  • In ancient times, plant and animal remains got buried, compressed, and transformed into fossil fuels like coal. Burning of these
    11·1 answer
  • Near shore, larger sand and gravel particles are moved along the ocean bottom by _____.
    11·2 answers
  • 2. What's the difference between a population and a community in an ecosystem!
    6·1 answer
  • Hi! Could You Help Me? - Pick A Scenario That You Believe Will Have The Greatest Impact On A Food Web In Your Local Ecosystem An
    15·1 answer
  • 5. Can this difference lead to differential reproductive success within the moth population? How and
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!