1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kamila [148]
3 years ago
13

Which discovery supported the endosymbiotic theory?

Biology
1 answer:
Ivenika [448]3 years ago
8 0
Mitochrondria of the eukaryotic cells.
<span>As many researchers hypothesize that the old single-celled organism or the origin of the complex-celled organisms came from the endosymbiosis of the mitochrondrion organism and the prokaryotic cell. It has been said that mitochondria was an independent organism which then to have been evovled itself after planting itself inside a prokaryotic cell which aided cellular respiration and production of ATP (Adenosine Triphosphate). This then aided the prokaryotic cell to be more sophisticated and caused another change from having without a true nucleus to a eukaryotic cell with a nucleus and embedded DNA. <span>
</span></span>
You might be interested in
What could happen to the environment if there were no environmental scientists to monitor it? (Site 2)
lozanna [386]

. great increase in air, land and water pollution; no one to ensure proper disposal of toxic

5 0
4 years ago
Which two features of igneous rocks are determined by their cooling rate?
-Dominant- [34]

Answer:

Crystal Size and Rock Texture

Explanation:

Extrusive rocks are also known as volcanic rocks. Igneous rocks are classified according to their texture and mineral or chemical content. The texture of the rock is determined by the rate of cooling. The slower the rock cools, the larger the crystals form.

6 0
3 years ago
Human blood consists of blood groups A, B, and O. However, there is one more blood group, AB, which contains alleles A and B in
KiRa [710]

Answer:

Blood group AB

Explanation:

4 0
3 years ago
Good posture is Group of answer choices A. Proper alignment that feels stiff B. Proper alignment of the head and back C Balance
erica [24]

Answer:

E. Proper alignment of the musculoskeletal system

Explanation:

Good posture is the correct alignment of the body when standing, sitting or in a lying position. It is a proper position of the body in which does not put much strain on your muscles and ligaments during movement or nonmovement, as well as when performing exercises or engaging in weight lifting exercises. Good body posture keeps all your bones and joints in proper alignment to ensure effective and correct use of your muscles.

5 0
3 years ago
What is the complementary strand for this segment of DNA? ​I'll give u 15 point pls answer
Fittoniya [83]
I think it’s TACGTTTAACGAGTGGCCCTAGTCGTGGCC
8 0
4 years ago
Other questions:
  • Scientists found a layer of rock with several different fossils in it, as shown in the image. Based on the model, which of these
    8·2 answers
  • A woman at 36 weeks’ gestation is admitted to the hospital to receive a tocolytic medication in an attempt to stop labor. In add
    12·1 answer
  • explain why cells don't just continue to grow larger as organisms grow larger. why do cells divide? please help and write in com
    11·1 answer
  • The use of non-local resources is associated with certain economic and environmental consequences.
    7·2 answers
  • Both coal and diamonds are forms of elemental carbon. Coal is brittle while diamonds are considered to be the hardest of all sub
    14·2 answers
  • How do the hormones of the endocrine system act as a feedback mechanism for the menstrual cycle?
    10·1 answer
  • Water in plants can be lost through what​
    7·1 answer
  • What are the Everglades?
    7·1 answer
  • Help me with this question plzz!​
    12·1 answer
  • Dna replicates during which phase of the cell cycle
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!