1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
faust18 [17]
4 years ago
12

A researcher proposes a model to explain how enzyme-substrate interactions determine enzyme specificity. The model is based on t

he idea that substrate molecules form favorable interactions with the amino acid side chains in an enzyme's active site.
Biology
1 answer:
schepotkina [342]4 years ago
6 0

Answer:

A substance that accelerates a chemical reaction, and that is not a reagent, is called a catalyst. The catalysts of the biochemical reactions that occur in living organisms are found as enzymes. These proteins are also proteins, although some ribonucleic acid (RNA) molecules also act as enzymes.

Enzymes executed the fundamental task of decreasing activation energy, that is the amount of energy that a reaction must be added in order for this audience. Enzymes operated by binding to the reagent molecules and sustaining them in such a way that the processes that form and break chemical bonds happen more easily.

Let's clarify an important point, enzymes do not change the ∆G value of a reaction. That is, they do not change if a reaction releases or absorbs energy in general. This is because enzymes do not affect the free energy of reagents or products.

Instead, enzymes decrease the energy of the transition state, an unstable state through which reagents must pass to become products. The transition state is at the top of the "hill" of energy in the previous diagram.

Active sites and substrate specificity

To catalyze a reaction, an enzyme sticks (binds) to one or more reagent molecules. These molecules are the substrates of the enzyme.

In some reactions, a substrate breaks into several products. In others, two substrates join together to create a larger molecule or to exchange parts. In fact, for any biological reaction that can occur to you, there is probably an enzyme to accelerate it.

The part of the enzyme where the substrate binds is called the active site (since that is where the catalytic "action" occurs).

You might be interested in
Which correctly lists three properties that are used to identify minerals? luster, weight, streak magnetism, size, weight size,
Dovator [93]

Answer:

luster, streak, hardness, cleavage, fracture, and crystal form are the most useful physical properties for identifying most minerals. Other properties-such as reaction with acid, magnetism, specific gravity, tenacity, taste, odor, feel, and presence of striations-are helpful in identifying certain minerals.

5 0
3 years ago
Read 2 more answers
How does pH and temperature affect cellular respiration?
Ray Of Light [21]
PH – depends on the environment the cell that is respiring is in.

Temperature; as it increases, the rate increases…to a point (too hot and enzymes denature!)
4 0
3 years ago
What process brings energy and matter into living systems
Lerok [7]

Answer:

Photosynthesis

Explanation:

This is a role in the cycling of matter and flow of energy into and out of organisms. The flow of energy and cycling of matter can be traced.

8 0
3 years ago
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
miss Akunina [59]
A because like what even is this??
4 0
3 years ago
What is the purpose of replication?
Greeley [361]

The purpose of DNA replication is to produce two identical copies of a DNA molecule. This is essential for cell division during growth or repair of damaged tissues. DNA replication ensures that each new cell receives its own copy of the DNA.

8 0
3 years ago
Other questions:
  • What makes up the "tail" of an ATP molecule? 3 phosphate groups ribose adenine 2 phosphate groups
    9·1 answer
  • Two kittens are sleeping by a furnace vent. they are relying mainly on what kind of heat transfer?
    14·2 answers
  • Can you please answer this?
    5·2 answers
  • Define and give an example for each term:
    6·1 answer
  • Http://kippmemphisburesh.weebly.com/uploads/2/2/5/8/22584312/quiz_10_pdf.pdf
    15·1 answer
  • An organic compound formed is the dark reaction of photosynthesis is
    10·2 answers
  • What gives sperms motility​
    5·1 answer
  • What do you do when you land on a island and your boat has crashed?
    15·2 answers
  • What was special about the nucleus?
    9·1 answer
  • The periosteum is secured to the underlying bone by ________.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!