1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alik [6]
3 years ago
6

The red sizing bead in this image is 10um in diameter. What is the length of a chloroplast? a20um b100um c2um d1um e10um

Biology
1 answer:
ella [17]3 years ago
7 0
I think the length is a20um
You might be interested in
Does the PLANT CELL have a CYTOSKELETON?<br> A. Yes<br> B. No
frutty [35]
A. Yes is correct. Hope that helps!
5 0
3 years ago
Help me pleeeeeaaasssseeee
IrinaK [193]
Sorry but I don’t know
7 0
3 years ago
What are the three stages of the cell cycle?
eimsori [14]
In the cells with nucleus, as in eukaryotes, the cell cycle is also divided into three periods which are: Interphase- the mitotic (M) phase, and cytokinesis. During interphase the cell growth accumulating nutrients needed for mitosis preparing it for cell division and duplicating its DNA
8 0
3 years ago
The simplest structured unit of a compound is a(n):<br> electron<br> atom<br> proton<br> molecule
tiny-mole [99]
The answer is molecule
8 0
3 years ago
Read 2 more answers
Asexual reproduction produces _____.
Sauron [17]
Asexual reproduction produces <span>a direct clone of the parent.
The other terms are related to sexual reproduction.

Asexual reproduction or asexual reproduction is a mode of reproduction, which (as opposed to sexual reproduction) corresponds to the capacity of living organisms to multiply alone, without a partner, without involving the fusion of two gametes of opposite sexes.

The mechanism of the reproduction is by </span>mitosis, <span /><span>budding or </span>scissiparity.<span>
</span><span>
</span>
3 0
3 years ago
Other questions:
  • Which would be a result of increased deforestation?
    13·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What did Tanya, a student in Robert Full's lab, need to figure out before she could answer her question?
    13·1 answer
  • Why is it necessary for Vibrio vulnificus to turn on different genes when the microbe invades a human
    13·1 answer
  • El alelo B determina el color rojo de las plumas de una especie de pájaro, y domina sobre b que determina el color blanco de las
    12·1 answer
  • Which unit of measurement should be used to describe the mass of a apple
    14·1 answer
  • Describe the process of chromatographic separation. You need to include both the equilibrium model to predict retention times an
    12·1 answer
  • A rock with a mass of 10.0kg is balanced on top of a large boulder describe the forces acting on the rock
    5·1 answer
  • What adverse effects does covering the land with concrete and asphalt create?
    12·1 answer
  • Can you identify the characteristics of plants that typically grow in early and late stages of secondary succession in an abando
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!