1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nadya68 [22]
3 years ago
11

Is a horse a herbivore or carnivore or omnivore

Biology
2 answers:
Snowcat [4.5K]3 years ago
7 0
Yes a horse is a hervivore because it eat things such as plants, grass, and leave so yeah that explains it.

UNO [17]3 years ago
5 0
A horse is an herbivore because they do not eat other animals.  Horses strictly eat plants, grass, and hay and such.  But not other animals.
You might be interested in
What are three types of genetic mutations
padilas [110]

Answer:

Cancer

Lung problems

Twins

3 0
3 years ago
Read 2 more answers
A remarkable fact about cells its that
azamat
Cells are very different but have similar properties
6 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
What is meant by heridity? ​
densk [106]

Answer:

Heredity, also called inheritance or biological inheritance, is the passing on of traits from parents to their offspring; either through asexual reproduction or sexual reproduction, the offspring cells or organisms acquire the genetic information of their parents

3 0
3 years ago
What is the largest flower in the world?
kykrilka [37]

Answer:

<u>Rafflesia arnoldii</u>

Explanation:

The flower with the world's largest bloom is the Rafflesia arnoldii. This rare flower is found in the rainforests of Indonesia. It can grow to be 3 feet across and weigh up to 15 pounds! It is a parasitic plant, with no visible leaves, roots, or stem.

8 0
3 years ago
Other questions:
  • Cardiac muscle cells are _ like skeletal muscle fibers
    7·1 answer
  • Explain the relationship between DNA replication and cell division.
    6·1 answer
  • A biologist is in the process of classifying and newly discovered fungus. The fungus is a decomposer and has sac-like structures
    5·2 answers
  • Ras is a g-protein that is activated when a growth factor attaches to egfr. its activation results in the in the exchange of gtp
    12·2 answers
  • A sonar system measures distance by determining the ______________it takes for sound waves to bounce off a surface.
    6·2 answers
  • Plasma membranes are stored where in eukaryotes?
    8·1 answer
  • -os planeta primários são os que giram a voltas dos planetas principais como por exemplo lua?​
    6·1 answer
  • Which of the following statements illustrate how fossils record the evolution of defensive mechanisms over time? which ever one
    6·1 answer
  • Students place a layer of water on aboard. next, they put a breaker of the water on top of the layer of the water and add ammoni
    5·1 answer
  • Hahahahhahhhzha shshhshs
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!