1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aivan3 [116]
3 years ago
8

Help please!!

Biology
1 answer:
sdas [7]3 years ago
6 0

Answer:

Better healthcare

Rise in birthrate

Food security

Lack of awareness/ education

Cultural influences

Lack of family planning

Religious propagation

Malicious intent to change demographics

Immigration

For Social support

Perception of marriage & family.

Explanation:

This rapid population growth has an adverse effect on the natural resources and quality of life.

However, overpopulation has a deleterious effect on the environment due to the current lifestyle.

There would be rampant exploitation of natural resources, excess human waste accumulation, chances of epidemics, etc.

Besides, it would also lead to socio-economic problems like poverty, malnutrition, violence, corruption, etc.

Human overpopulation occurs if the number of people in a group exceeds the carrying capacity of the region occupied by that group.

You might be interested in
Gene mutations can be positive, negative, or neutral. Suppose that the normal gene in Model 2 produced a polypeptide that was ne
Zolol [24]

Gene mutations can be positive, negative, or neutral. Suppose that the normal gene in Model 2 produced a polypeptide that was necessary for cellular respiration.

A) Choose a mutation from those in Model 2 that might be positive for a cell. Explain your reasoning by relating the mutation to the cellular respiration process.

Genes encoded in our DNA result in the production of proteins that perform specific functions  within human's cells and various environmental factors and spontaneous events can lead to changes in genes, these changes are called mutations, can lead to alterations in the structure and activity of the proteins in the cells use. Mutations are the source of all new alleles in nature and arise spontaneously at low frequency owing to the chemical instability of purine and pyrimidine bases and to errors during DNA replication. Therefore,a gene mutation is a change in the sequence of nucleotides that occurs during cell replication  (mitosis and meiosis) within a single coding section of DNA. Variations in alleles lead to variations in organisms  within a population, cellular respiration, i.e. the reduction of inspired oxygen to water, which powers cell function, also generates highly reactive oxygen species that can damage DNA, with the purine bases G and A being particularly susceptible to this kind of attack,so Positive mutations lead to the organism having a better chance of survival, which  means the mutation may be passed on to the offspring.

B) Choose a mutation from those in Model 2 that might be negative for a cell. Explain your reasoning by relating the mutation to the cellular respiration process.

Due to one's metabolism, the human body replaces every cell within the cellular respiration process and any mistakes can also occur in the  transcription of mRNA or the translation of a polypeptide. However, these changes are considered to be negative mutations, because they are not permanent changes to the cell, however such mutations may lead to an early death probably before the organism can produce offspring.

3 0
3 years ago
Which statement about the composition of membranes is TRUE? The inner and outer membranes of mitochondria have different protein
wel

Answer: Option A

Explanation:

The correct statement is that the there is a difference in protein which is found in the outer membrane and inner membrane of the mitochondria.

The inner membrane of the mitochondria is folded to allow maximum surface area for the energy production.

The inner part of the mitochondria contains the enzyme ATPase for energy production.

The outer membrane of the mitochondria contains enzymes for the export and import of the various materials with the help of  TOM40 complex and TIM23 complex.

4 0
4 years ago
WILLLGIVE A BRAINLEST
o-na [289]
The answer for this is legumes.
8 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
60 POINTSSS ASAAAAAAPPPP + BRAINLIEST
Nonamiya [84]

Answer:

Ur answer is D. They should grow native plants on the lodging property to attract local wildlife.

Explanation:

Hope this helps :). Have a great day!

7 0
3 years ago
Other questions:
  • A scientist investigates two types of cells located in different parts in the human body. Cell A contains many more mitochondria
    7·2 answers
  • Which statement about energy is true?
    15·1 answer
  • A white mouse crossed with a black mouse all the offspring were grey the genes for fur color in mice show
    12·1 answer
  • A divide as it relates to Earth science is the
    14·1 answer
  • Why is my face round​
    11·1 answer
  • A period is the time required for half of the atoms of a radioactive element to decay
    11·2 answers
  • The creation of genetically identical offspring by a single parent, without the participation of sperm and egg, is called The cr
    10·1 answer
  • Helpppp meeeeeee..............................
    7·1 answer
  • The hormones that are released by the adrenal cortex and that play a key role in the body's response to long-term stressors are
    15·1 answer
  • Which of the following requires treatment with both antibiotics and antitoxins? A) diphtheria. B) tuberculosis. C) whooping coug
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!