1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mnenie [13.5K]
3 years ago
13

A plant has a genetic defect that causes its leaves to dry out, becoming brittle and prone to injuries. The genetic defect most

likely causes each leaf to lack a ______
Biology
2 answers:
pickupchik [31]3 years ago
7 0

The genetic defect most likely causes each leaf to lack a sufficient root system that can support the plant's growth.

The root system of plants contains networks of roots and their branches which functions by absorbing and transporting water and dissolved minerals from the soil to the plant in order to support the growth of the plant. They anchor (hold) the plant in the soil and also store reserve foods that can be used later by plants. Absence of sufficient root system in plants will affect the plants normal processes (including photosynthesis). The plant’s water absorbing capacity will be greatly reduced and this will make the plant to become dry (weak) and to be susceptible to insect and diseases.

KengaRu [80]3 years ago
3 0

Answer:

It would be  sufficient root dont forget to follow me on instagram

Explanation:

You might be interested in
Cutting down vast tracks of rain forest may result in a loss of all the following environmental effects, except which one?
Harrizon [31]
 Your answer would be oil
3 0
3 years ago
Read 2 more answers
Ticks suck blood from a host organism. This is an example of
kherson [118]
I'm pretty sure the answer is D
4 0
3 years ago
Why are gymnosperms no longer restricted to moist environments, as are ferns and mosses?
erastovalidia [21]

Gymnosperms are no longer restricted to moist environments, as are ferns and mosses because they have evolved to produce non-flagellated pollens that do not require water or moisture to reach the egg whereas ferns and mosses have flagellated sperm that needs moisture to swim towards the egg.

Another major evolutionary adaption in gymnosperms is the production of seeds instead of spores since seeds contain their own nutrition in the form of endosperm, seeds can travel large distances through wind or animals and can germinate when they find suitable conditions. Seeds can remain dormant for several years whereas spores have a shorter lifespan.

To learn more about endosperm here

brainly.com/question/87065

#SPJ4

7 0
2 years ago
Show how artificial selection could be used to develop a new breed of wheat with higher fiber content
siniylev [52]

Answer:

get wheat that has the desired content (in this case high fiber content)

breed them

amongst the offsprings/ wheat produced, select the ones with highest fiber content

breed them

repeat this process for many generations

Explanation:

4 0
3 years ago
Can someone rephrase this "The climate in the boreal forest is characterized by long, very cold, dry winters and short, cool, mo
Arte-miy333 [17]

Answer:

"Long, bitterly cold, dry winters and short, cool, damp summers define the boreal forest climate. The boreal forest is alive with activity. In the winter, their conical forms decrease snow buildup on branches, preventing them from breaking under the weight of the snow."

Explanation:

Hope this helps! :)

6 0
2 years ago
Other questions:
  • Cells have these specilized structures within them that function to perform a task for the cell.
    9·1 answer
  • Explain the relationship between inputs and outputs in cellular respiration and photosynthesis for an organism
    14·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • An organism starts growing out of the parent organism. It may or may not remain attached to the parent organism. What is this ty
    13·2 answers
  • Most of the dissolved substance in sea water is:<br> nitrogen<br> hydrogen<br> chlorine<br> sodium
    5·1 answer
  • What is the purpose of having ampicillin in the plate?
    11·1 answer
  • For which reasons would a male peacock spread his tail feathers?
    11·1 answer
  • Which website most likely provides reliable information about climate change?
    6·2 answers
  • Types of amino acids​
    13·1 answer
  • Is it safe to use it
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!