1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nadezda [96]
3 years ago
5

What is the maximum number of amino acids in a peptide that would be produced from the following mRNA sequence: 5′ AAUCCGUAAAUGA

GACCGUCGAUCAAUUAGCG 3′?
Biology
1 answer:
Neporo4naja [7]3 years ago
8 0

Answer:

10 amino acids

Explanation:

Gene expression generally involves the synthesis of gene products usually proteins. This process is achieved in two major stages: transcription and translation. Transcription is the copying of the nucleotide sequence in the DNA molecule into a mRNA molecule while Translation is the use of the transcript (mRNA) as a template for amino acid synthesis.

The translation occurs in the RIBOSOME where mRNA nuceleotide sequence is read in a group of three nucleotides called CODON. These codons make up the genetic code. Each codon specifies a particular amino acid. In this case where we have a mRNA of nuceleotide sequence: 5′ AAUCCGUAAAUGAGACCGUCGAUCAAUUAGCG 3′

There are 32 nucleotides all together, the nuceleotides are read in a group of three (codon) starting from the beginning. We'll have 10 codons using this principle with two extra nucleotides left. Since each CODON specifies one amino acid, 10 codons will specify 10 amino acids in the peptide chain.

You might be interested in
During photosynthesis, cells capture the energy of sunlight using (thylakoid / stroma / NADPH / chlorophyll), which is a type of
Alla [95]

Answer:

Chlorophyll

Pigment

NADP+

Carrier

Explanation:

Photosynthesis is the process where green plants synthesize their food in form of sugars using sunlight energy. Photosynthetic process occurs in two stages namely: Light dependent stage and Light independent stage.

In the light dependent stage, which occurs in the thylakoid lumen, cells capture the energy of sunlight using CHLOROPHYLL, a type of PIGMENT found in the chloroplast. However, photosynthesis also relies on a compound called NADP+, which serves as an ELECTRON CARRIER that accepts electrons to become NADPH and transfers its stored high-energy electrons.

5 0
2 years ago
What limits cell division?
Murljashka [212]
They need to have the exact copy of the cell, so it does takes time.
8 0
3 years ago
Read 2 more answers
If a rat births several offspring after fertilization, why will these offspring NOT be genetically identical to the mother
Nataly_w [17]

Answer: The offspring will not be genetically identical to the mother because the process of mitosis mixes chromosomes frome the mom and dad.

7 0
2 years ago
Multiple choice question
Evgesh-ka [11]

Answer:

a chain of amino acids makes a protein

7 0
2 years ago
Read 2 more answers
Bones do not have a role in __________. bones do not have a role in __________. support movement glycogen production fat storage
mafiozo [28]
The correct answer is that bones do not have a role in glycogen production. Glycogen is only produced by two organs of the body; the muscles and the liver. Bones and bone structures function to support movement by serving as insertions for the muscles. The tissue inside the bone is called the bone marrow; which is divided into red marrow (functions for blood cell formation) and yellow marrow (functions to store fat).
8 0
3 years ago
Read 2 more answers
Other questions:
  • Bacteria, such as E.coli are simple, single-celled (unicellular) organisms. Elodea, also known as water weed, is a plant that is
    12·1 answer
  • All of the statements EXCEPT one are true about mutations. Which statement is false?
    15·2 answers
  • What would be the first thing you would do if you are burned by a chemical while performing a man experiment
    13·1 answer
  • Canada, Russia and _____ are areas of large oil reserves.
    7·2 answers
  • What is the primary function of the calvin cycle?
    6·1 answer
  • n electron micrographs of HSV infection, it can be seen that the intact virus initially reacts with cell-surface proteoglycans,
    10·1 answer
  • The dynamo theory states that earths magnetic field is created in the later known as the
    7·2 answers
  • Any one here trans ftm or mtf?
    8·1 answer
  • These three questions​
    9·1 answer
  • What are the reactants of photosynthesis?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!