1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nadezda [96]
3 years ago
5

What is the maximum number of amino acids in a peptide that would be produced from the following mRNA sequence: 5′ AAUCCGUAAAUGA

GACCGUCGAUCAAUUAGCG 3′?
Biology
1 answer:
Neporo4naja [7]3 years ago
8 0

Answer:

10 amino acids

Explanation:

Gene expression generally involves the synthesis of gene products usually proteins. This process is achieved in two major stages: transcription and translation. Transcription is the copying of the nucleotide sequence in the DNA molecule into a mRNA molecule while Translation is the use of the transcript (mRNA) as a template for amino acid synthesis.

The translation occurs in the RIBOSOME where mRNA nuceleotide sequence is read in a group of three nucleotides called CODON. These codons make up the genetic code. Each codon specifies a particular amino acid. In this case where we have a mRNA of nuceleotide sequence: 5′ AAUCCGUAAAUGAGACCGUCGAUCAAUUAGCG 3′

There are 32 nucleotides all together, the nuceleotides are read in a group of three (codon) starting from the beginning. We'll have 10 codons using this principle with two extra nucleotides left. Since each CODON specifies one amino acid, 10 codons will specify 10 amino acids in the peptide chain.

You might be interested in
Which types of selection forces act here
Ierofanga [76]

Answer: directional selection, disruptive selection and stabilizing selection

Explanation:

Natural selection is when organisms adapt to the environment and pass down these adaptations to their offspring when they breed

5 0
3 years ago
What are the names of four polysaccharides and what is required for their formation?
dem82 [27]
The four polysaccharides are glycogen, starch, cellulose, and chitlin.  You consume them. They are sometimes artificially made or produced by your body.
7 0
2 years ago
What is cell cycle ??​
Mumz [18]

Answer:

A cell cycle is a series of events that takes place in a cell as it grows and divides

Explanation:

hope it helps

good day ✌️

4 0
3 years ago
Read 2 more answers
Growing a nursery of crop seedlings then transplanting them at the appropriate time is a facet of which agricultural technique?
Jobisdone [24]

Answer:

rice cultivation.

Explanation:

There are two methods of sowing a crop in the field i. e. sowing of seed and transplanting. Seeds sowing in the field is used for almost all the crops except rice in which transplantation is done. In transplanting method, plants are grown inside a nursery and when the plant reaches to a certain height, it is transported to the field. This method is done in the cultivation of paddy rice because water is present at a certain height in the field and rice is the only crop in which roots respire in water.

5 0
2 years ago
Describe the movement of the dominoes as energy is transferred through them and then compare the movement of longitudinal waves
alexdok [17]

Answer:

The waves move outwards from where the rock hit. When the waves pass the wood, it bobs up and down. In the case of the falling dominoes, the movement of the dominoes was in the direction parallel to the movement of the wave, longitudinal.

Explanation:

Hope this helps :D

4 0
2 years ago
Other questions:
  • A nurse is caring for an older adult client with delirium. which intervention will most effectively reduce the client's risk for
    12·1 answer
  • The level of carbon dioxide was measured in a garden and on a city road. Where do you think the carbon dioxide level will be hig
    14·2 answers
  • What can radiometric dating reveal
    8·2 answers
  • Which of these belongs to a trophic level that receives energy directly from the initial source?
    5·1 answer
  • Can y’all tell me which ones I got wrong please. Thank you!!
    7·1 answer
  • (PLEASE HELP MEH, IM 2 STOOPID)
    12·1 answer
  • The liver and pancreas are both human body organs. Which of the following correctly compares the two organs?
    14·1 answer
  • The following reaction is of photosynthesis:
    12·1 answer
  • Channel between the middle ear and the nasopharynx.
    14·1 answer
  • Pls help fast!<br> I wanted to see if my answers were right<br> which are : A, B D.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!