1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nadezda [96]
3 years ago
5

What is the maximum number of amino acids in a peptide that would be produced from the following mRNA sequence: 5′ AAUCCGUAAAUGA

GACCGUCGAUCAAUUAGCG 3′?
Biology
1 answer:
Neporo4naja [7]3 years ago
8 0

Answer:

10 amino acids

Explanation:

Gene expression generally involves the synthesis of gene products usually proteins. This process is achieved in two major stages: transcription and translation. Transcription is the copying of the nucleotide sequence in the DNA molecule into a mRNA molecule while Translation is the use of the transcript (mRNA) as a template for amino acid synthesis.

The translation occurs in the RIBOSOME where mRNA nuceleotide sequence is read in a group of three nucleotides called CODON. These codons make up the genetic code. Each codon specifies a particular amino acid. In this case where we have a mRNA of nuceleotide sequence: 5′ AAUCCGUAAAUGAGACCGUCGAUCAAUUAGCG 3′

There are 32 nucleotides all together, the nuceleotides are read in a group of three (codon) starting from the beginning. We'll have 10 codons using this principle with two extra nucleotides left. Since each CODON specifies one amino acid, 10 codons will specify 10 amino acids in the peptide chain.

You might be interested in
What are the possible effects of a frontal system entering an area? Select all that apply. A. gentle rain B.sea breeze C.clearin
Andreas93 [3]
The answer for that is B, and E it should be all in your book
5 0
3 years ago
Read 2 more answers
Carbon chains are principal features of both carbohydrates and lipids.what is the primary difference between these two types of
solong [7]
While both carbohydrates and lipids are made up of carbon, hydrogen and oxygen there are several differences:

1. Carbohydrates are chains of 2 or more carbon atoms.  These can be very lengthy (like long cellulose chains of glucose units). They have many polar OH groups (e.g. glucose - C6H6O6). Most carbohydrates are hydrophilic and are soluble in water because of their polar OH groups. They are not necessarily sugars nor are they necessarily sweet. They are also important components of DNA, RNA and ATP.

2. Lipids are more diverse in their chemistry. They generally have a polar region at one end (this end attracts water) and a large non polar hydrocarbon region that repels water. Lipids don't dissolve in water and instead clump together with their hydrocarbon regions on the interior. Lipids include oils, fatty acids, waxes, steroids and hormones.
4 0
3 years ago
Which of the following is an example of groupthink?
Sliva [168]

Answer:

The Bay of Pigs invasion

Explanation:

The Bay of Pigs invasion was an attempt of Cuban exiles to destroy the government of Fidel Castro. These were actions of the USA aimed against Cuba. This invasion was one unsuccessful try and shame for the regime of Kenedy. This was an example of a group decision that was unsuccessful. Ths attempt provoked many side effects, as entering of Cuban-Americans in the Congress of America.

4 0
3 years ago
Please explain the words above with your own words
aksik [14]

Ribosomes - An organelle that creates proteins.

Golgi Apparatus - Moves lipids around the cells, also modify's, sorts, and packages proteins.

Hope this helps!

6 0
3 years ago
What are causes of high temperatures inside Earth?
Vika [28.1K]
Radioactivity due to heavy elements
Friction caused by earths fast rotation
6 0
3 years ago
Read 2 more answers
Other questions:
  • Which statement correctly compares the transfer of genetic material during mitosis and meiosis?
    11·1 answer
  • What prevents a white dwarf from completely collapsing upon itself?
    9·2 answers
  • What happens to the quantity of clean water as water pollution increases
    10·1 answer
  • Do you think all living organisms have the same types of cells why or why not​
    7·2 answers
  • What is gravity and how does it assist in erosion?
    10·1 answer
  • What is meant by the overload principle? what is meant by the overload principle? stretching a muscle group beyond the joint's h
    5·1 answer
  • Explain the process that creates wind
    9·2 answers
  • Explain the characteristics scientists use when
    10·2 answers
  • Function of cytoplasms
    11·1 answer
  • A group of lions are called a pride. A group of cattle can be called a herd. What is the name for a group of lobsters? Please he
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!