1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nadezda [96]
3 years ago
5

What is the maximum number of amino acids in a peptide that would be produced from the following mRNA sequence: 5′ AAUCCGUAAAUGA

GACCGUCGAUCAAUUAGCG 3′?
Biology
1 answer:
Neporo4naja [7]3 years ago
8 0

Answer:

10 amino acids

Explanation:

Gene expression generally involves the synthesis of gene products usually proteins. This process is achieved in two major stages: transcription and translation. Transcription is the copying of the nucleotide sequence in the DNA molecule into a mRNA molecule while Translation is the use of the transcript (mRNA) as a template for amino acid synthesis.

The translation occurs in the RIBOSOME where mRNA nuceleotide sequence is read in a group of three nucleotides called CODON. These codons make up the genetic code. Each codon specifies a particular amino acid. In this case where we have a mRNA of nuceleotide sequence: 5′ AAUCCGUAAAUGAGACCGUCGAUCAAUUAGCG 3′

There are 32 nucleotides all together, the nuceleotides are read in a group of three (codon) starting from the beginning. We'll have 10 codons using this principle with two extra nucleotides left. Since each CODON specifies one amino acid, 10 codons will specify 10 amino acids in the peptide chain.

You might be interested in
Which is a difference between the Paleozoic and Mesozoic era?
Snowcat [4.5K]

Explanation:

Animals lived in the water during the Mesozoic and on land in the Paleozoic. Animal complexity increased during the Paleozoic while the first flowering plants appeared in the Mesozoic era. ...

The Paleozoic era, not the Mesozoic era, had the first dinosaurs. The first mammals emerged in the Paleozoic era, not the Mesozoic era. The Mesozoic era, not the Paleozoic era, had the first animals with shells.

6 0
3 years ago
Which organisms convert nitrogen into a form that is usable by humans?
White raven [17]
Yes it’s C I agree
5 0
3 years ago
1)
DanielleElmas [232]
Cellulose is another long polymer of glucose. Plant cells make their cell walls out of cellulose. In fact, 100 billion tons of cellulose is made every year on earth. Cellulose is indigestible in most animals, including us. Ever eat a cardboard box? You get the picture. We simply lack cellulase, the enzyme that can break it down. Some bacteria, some single-celled protists, and fungi have the enzyme. Animals that feed on cellulose harbor these microbes that help them digest it. Even though, we cannot break down this molecule, we do need cellulose in our diet. We call it “fiber”. Cellulose stimulates the colon to produce regular bowel movements and helps make the stools large and soft. A diet rich in fiber can prevent a painful intestinal disorder called diverticulosis. Hard impacted stools can sometimes cause the walls of the colon to form blind outpockets called diverticula which can periodically inflame. So what makes cellulose different from starch? Isn’t it made of glucose? Well it is but the glucose monomers are organized in an interesting fashion. The orientation of the glucose molecules alternates. So if the first one is right side up, the next one is upside down and then the next is right side up and the next one is upside down. Apparently this is a tricky arrangement for an enzyme to break.
7 0
3 years ago
What would be the answers for 33-34?
RUDIKE [14]

Answer:

chromosome

or venue mutations

6 0
2 years ago
Farmers sprayed leechi trees to suppress populations of scale insects. this also killed the populations of a predatory lacewing
Ahat [919]

Answer:

few predatory lacewings exist in the trees now because they were killed by the spray.

Explanation:

The spray that farmers used, as noted, also killed the populations of a predatory lacewing.

Due to this, few predatory lacewing remained that could not fully deal with the scale population.

This in turn led to the multiplication of scale now that their predators had been done away with.

8 0
2 years ago
Other questions:
  • Given the nucleotide sequences below, what type of mutation has occurred?
    13·1 answer
  • Explain the functions of a nervous system
    12·1 answer
  • New research is using functional MRI (magnetic resonance imaging), a scan of the brain that highlights specific areas of the bra
    10·1 answer
  • What can you conclude from the graph?
    11·2 answers
  • Principles of Ecology: Part 4 FANR/MARS 1100 Law of Tolerance Survival depends on _________________________ of many factors, whi
    11·1 answer
  • Precipitation is less likely to occur under
    6·1 answer
  • What term is defined as the aptitude of some individuals to be better suited for survival and reproduction?
    9·1 answer
  • The two sides of the DNA helix are held together by
    12·2 answers
  • Which type of plant tissue contains open vessels that transport water, irons, materials and nutrients throughout a plant
    6·1 answer
  • What specifically separates during meiosis ii?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!