Question

What is the maximum number of amino acids in a peptide that would be produced from the following mRNA sequence: 5′ AAUCCGUAAAUGAGACCGUCGAUCAAUUAGCG 3′?

Answer 1

Answer:

10 amino acids

Explanation:

Gene expression generally involves the synthesis of gene products usually proteins. This process is achieved in two major stages: transcription and translation. Transcription is the copying of the nucleotide sequence in the DNA molecule into a mRNA molecule while Translation is the use of the transcript (mRNA) as a template for amino acid synthesis.

The translation occurs in the RIBOSOME where mRNA nuceleotide sequence is read in a group of three nucleotides called CODON. These codons make up the genetic code. Each codon specifies a particular amino acid. In this case where we have a mRNA of nuceleotide sequence: 5′ AAUCCGUAAAUGAGACCGUCGAUCAAUUAGCG 3′

There are 32 nucleotides all together, the nuceleotides are read in a group of three (codon) starting from the beginning. We'll have 10 codons using this principle with two extra nucleotides left. Since each CODON specifies one amino acid, 10 codons will specify 10 amino acids in the peptide chain.