1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sveta_85 [38]
3 years ago
7

Global warming is causing the ice caps to melt. What is the most likely effect

Biology
1 answer:
e-lub [12.9K]3 years ago
3 0

Answer:

Many land animals will starve.

You might be interested in
List three reasons why biodiverstiy conservation is important
svlad2 [7]

Answer:

The result of loss of topsoil are loss in fertility of soil, loss of water, crop production and hardened soil surface. Therefore, the correct answer to the above question is option A, B, C and D.  

Explanation:

When there is a loss of top layer of soil from the earth by any means, natural or artificial, it is known as soil erosion. The soil from one place gets detached and is transported to another area. Planting more and more trees is the one of the way to stop soil erosion as the roots of the plants hold the soil.  

When the soil from area is removed there is a loss of production in crop due to various reasons. The most fertile part of the soil occurs in the uppermost part.  Therefore, its removal has negative impact.  

3 0
3 years ago
Qué declaracion mejor describe la reproducción entre bacterias en condiciones ideales?
Anestetic [448]

Answer:

this isn't biology

brainly.com/spanish

6 0
3 years ago
Which of the following represents an example of Mullerian mimicry?
Mumz [18]
<em>the correct option for this is B>></em>
5 0
3 years ago
True or false diabetes can contribute to gum disease
Marysya12 [62]
True, diabetes can contribute to gum disease.
6 0
3 years ago
Read 2 more answers
Protein synthesis involves (Hint...look at the diagram)
Dmitrij [34]

Answer:

A. DNA creating mRNA which is used to make a polypeptide

Explanation:

Protein synthesis process involves the DNA creating mRNA, which is used to make a polypeptide.

8 0
2 years ago
Other questions:
  • Roly-poly bugs will move around in no particular direction until they find a suitable moist spot this kind of random movement in
    8·2 answers
  • HELP ME PLEASEEEEE I WILL MAKE THEM THE BRAINLIST ANSWER IF YOU ANSWER NOW!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
    6·1 answer
  • Why is bicarbonate is mixed with water in the leaf disc experiment?
    11·1 answer
  • What role do stomata play in homeostasis
    8·1 answer
  • Lysosomes break down —————- materials. plant cells have ————- vacuoles than animal cells.
    9·1 answer
  • What is a trait give two examples
    6·2 answers
  • What are the advantages of Mempro ™ liposome technology?
    8·1 answer
  • What does cytoplasm do
    11·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • When anesthesia is given during surgery, the dose is calculated in ml based on the body weight in Kg. If the dose is not calcula
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!