1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SCORPION-xisa [38]
3 years ago
9

If someone can just give me an idea of what the answer is you don’t have to type out a full crq

Biology
1 answer:
saveliy_v [14]3 years ago
3 0

Explanation:

Actually, two organelles transport protein in a eukaryotic cell (multicellular organisms): (rough) Endoplasmic Recticulum and Golgi Apparatus.

The (rough) endoplasmic recticulum transport the newly synthesized proteins to the golgi apparatus from where they are transported to the various regions of the cell or outside the cell. Smooth endoplasmic recticulum is not associated with protein transport.

Proteins, carrying a signaling sequence, are transported from the endoplasmic recticulum, packaged into vesicles, to the golgi apparatus (or golgi complex or golgi bodies). These proteins are modified by enzymatic reactions as they move through the golgi apparatus. After processing, these proteins are either excreted from the cell or are sent to various locations within the cell. 

It is difficult to pinpoint the location of these organelles within the cell as locations are different for mammals, plants, yeasts, etc. Generally, the golgi apparatus is found adjacent to the endoplasmic recticulum, which in turn is found throughout the cell but has a higher density near the nucleus.  

You might be interested in
The large leaves of ferns show multiple venation what is it spores rhizomes or fronds
Mamont248 [21]
The answer is fronds
3 0
3 years ago
What is true about the Y chromosomes
AURORKA [14]

Answer:

The Y chromosome is present in males, who have one X and one Y chromosome, while females have two X chromosomes.Explanation:

4 0
3 years ago
Identify one way in which bacteria differ from humans. A. Bacteria are single-celled. B. Bacteria do not reproduce. C. Only huma
velikii [3]
The answer is A, bacteria can move around, use energy, and reproduce just like humans can, the only difference is they're single cell and we're not.
6 0
3 years ago
Read 2 more answers
Which polymers code for an organism's traits?
storchak [24]
C. nucleic acids (consisting of genes which encode for specific proteins to be synthetized)
4 0
3 years ago
Read 2 more answers
Substances that are poisonous are
3241004551 [841]
D. Toxic , the other options do not refer to something necessarily harmful to the human body or poisonous. Human hair is ignitable, acid in the stomach corrodes food through chemical reactions so toxic is the only option left.
8 0
3 years ago
Other questions:
  • Which of the following is a way that some animals' bodies adapt to living in extremely cold climates?
    5·1 answer
  • ¿Para qué los flamencos tienen patas largas?
    13·2 answers
  • Help me with these please
    6·1 answer
  • And produce
    8·2 answers
  • A nerve is actually a long threadlike bundle of ________ that conduct electrical impulses.
    13·1 answer
  • What type of volcano would you most expect to erupt?
    9·2 answers
  • If the organisms at level 2 were to decrease, explain what would happen to 6 points
    15·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • When do peppered moths hatch?
    12·2 answers
  • Which of Newton's laws is also known as the law of inertia?<br> im in 5th grade btw
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!