1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kruka [31]
3 years ago
13

What are the three pressures that lead to biodiversity

Biology
1 answer:
Sergio039 [100]3 years ago
3 0
1. Immigration
2. Emigration
3. Extinction events

You might be interested in
Which of the following pieces of information would serve as evidence that DNA is the source of heritable information?
chubhunter [2.5K]
The Hershey and Chase experiment concluded the same by labeling the DNA of the parents with phosphorous and found out that the DNA of the offspring also bear phospho- labeled DNA, which established the fact that DNA is the heritable information source. So, your answer is B. 
3 0
3 years ago
The nurse is teaching a new group of mental health aides. the nurse should teach the aides that setting limits is most important
liq [111]

The nurse is teaching a new group of mental health aides. The nurse should teach the aides that setting limits is most important for a manic client.

As the nurse is teaching a new group of mental health aides, so, she is talking about manic clients and mental health aides are the people who take care of patients with mental disorder either in house or any centers.

<span>Manic client have bipolar disorder in which there is many unusual shifts of mood.</span>

7 0
3 years ago
A mineral rated a 1 on the hardness sacle is
zlopas [31]

Answer:

Talc is rated a 1.

Explanation:

3 0
3 years ago
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
AnnyKZ [126]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

3 0
3 years ago
Living things contain units of structure and function that arise from preexisting units. This statement best describes the
galina1969 [7]

Answer:

cell theory

Explanation:

cells are the basic unit of structure in organism

5 0
4 years ago
Read 2 more answers
Other questions:
  • A plant cell placed in a solution with a lower (more negative) water potential will _____.
    10·1 answer
  • What does ithe mean if a molecule is moved against the concentration gradient ?
    15·2 answers
  • 9.) The number of times a gene occurs in a gene pool is
    12·1 answer
  • What is the name for a complex, organized group of organisms
    9·1 answer
  • Which statement best explains why radon and Krypton do not bond easily with other elements.
    14·2 answers
  • Any disease of the nerves:<br> A. neuropathy <br> b. peripheral neuropathy<br> C. PNS<br> d. CNS
    5·1 answer
  • 1. Sensitization makes a dog
    10·1 answer
  • What does ordered internal structure mean
    13·2 answers
  • 1. The primary factors affecting population growth
    10·2 answers
  • What is the main purpose of the extracellular matrix surrounding osteocytes?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!