1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nikitadnepr [17]
3 years ago
15

Cerebrospinal fluid is produced by the

Biology
1 answer:
nikklg [1K]3 years ago
7 0

Answer: Option A "Choroid plexus".

Explanation:

Cerebrospinal fluid can be defined as the fluid that is found in the brain and spinal cord of human beings. It is a clear and colorless fluid.

The production of cerebrospinal fluid takes place by the specialized ependymal cells that lies in the choroid plexuses which is present in the  ventricles of brain.

The amount of cerebrospinal fluid in a day is 500mL. This fluid acts as cushion that protects the brain from mechanical and immunological protection.

Hence, the correction answer is option A

You might be interested in
The classic Hershey and Chase (1952) experiment that offered evidence in support of DNA being the genetic material in bacterioph
irina1246 [14]
D...............SJSU’s
6 0
3 years ago
Can someone help me with these 2 questions please ?!
Bess [88]

Answer:

1 pretty sure its A and 2 i think its B

Explanation:

7 0
3 years ago
Read 2 more answers
Which of the following statements about fungi is not true? a. All fungi are useful for plant growth b. Athletes foot is caused b
Vera_Pavlovna [14]

Answer:

c

Explanation:

a is true , b athletes foot is caused by a type of fungi d fungi true since they are like magots.

5 0
3 years ago
A diagram demonstrating the process of protein translation is shown below.
ValentinkaMS [17]
That structure is the ribosome
3 0
3 years ago
A biological cycle, or rhythm, that is approximately 24 hours long is called a(n) ________ cycle
tankabanditka [31]

A biological cycle, or rhythm, that is approximately 24 hours long is called a circadian cycle

5 0
3 years ago
Other questions:
  • Unattached earlobes are dominant to attached earlobes. Cleft chin is dominant to no cleft. Parents that are heterozygous for bot
    8·2 answers
  • To find out which key will open a lock, you try several until one works. This kind of learning is called _______________________
    13·1 answer
  • Liquid krypton boilsat 121k what is the boiling point on the Celsius scale liquid helium boils at 4 k what is the boiling point
    6·1 answer
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • A thoracic motion segment contains the fibrous joint between the intervertebral disc and vertebral bodies, 2 intervertebral face
    11·1 answer
  • How does the growing human population impact the earth's natural resources, and in which countries is this most prominent? what
    14·1 answer
  • PLSS HELP ME!! I WILL GIVE YOU BRAINLYEST!!
    8·1 answer
  • Which part of the cell membrane prevets the cell from dissolving in water
    13·1 answer
  • Which of the following terms is the combining of male and female reproductive cells called?! A b or c
    9·1 answer
  • Where are the plant stem cells found
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!