1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jekas [21]
3 years ago
5

The increase in volume of the muscle fibers due to the enlargement of its components is referred to as

Biology
1 answer:
Lelu [443]3 years ago
8 0

Answer:

The increase in volume of the muscle fibers due to the enlargement of its components is referred to as hypertrophy.

Explanation:

Hypertrophy is about increasing the size of the transverse diameter of muscle fibers, it causes the muscle to grow in volume, due to the stimulation of the growth of muscle cells without cell division in the muscle. Hypertrophy occurs as a result of resistance training.

You might be interested in
Corbin recently found out that he has cancer, and he now strictly follows a treatment, diet, and exercise program that the docto
Firlakuza [10]

Answer:

Corbin recently found out that he has cancer, and he now strictly follows a treatment, diet, and exercise program that the doctor thinks will be helpful in keeping the cancer from spreading. These behaviors best illustrate <u>problem-focused</u> coping.

Explanation:

Problem-focused coping seeks to tackle the stressor head-on allowing the individual greater perceived control over their problem resulting in :

  • Managing and changing the stressor
  • Use if problem seems alterable
  • Confrontice coping
  • Planful problem solving

As Cobbin is strictly following treatment, diet and exercise programs that the doctor thinks will be helpful in keeping the cancer from spreading, Cobbin is showing <u>problem-focused coping.</u>

6 0
3 years ago
In pea plants, purple flowers are dominant over white flowers. The phenotype ratio of purple to white flowers in a population of
noname [10]
1. It’s 4 purple flowers to 1 white flower
6 0
3 years ago
Which is an adaptation for cold, snow-covered environments?
Natasha2012 [34]
Thicker Skin, Fur, More Fat Content 
6 0
4 years ago
Read 2 more answers
Which three body systems work together to obtain and distribute oxygen and nutrients?
dangina [55]
<span>respiratory circulatory digestive</span>
4 0
3 years ago
The ratio of estrogen to progesterone remains constant throughout pregnancy into labor. false/true
Lady_Fox [76]

False,

In order to start labor, estrogen increases and progesterone decreases.

Estrogens are a class of hormones that are essential for women's healthy sexual and reproductive development. They are sex hormones as well. The majority of estrogen hormones are produced by a woman's ovaries, however minor quantities are also produced in modest amounts by the adrenal glands and fat cells.

Progesterone is a member of the progestin drug class (female hormones). By lowering the level of estrogen in the uterus, it functions as a component of hormone replacement treatment. By substituting for the natural progesterone that some women lack, it helps to initiate menstruation.

To know more about pregnancy, click on the below link,

brainly.com/question/14353919

#SPJ4

5 0
2 years ago
Other questions:
  • When would be a good time in San Francisco to collect seashells? Explain your answer.
    6·2 answers
  • Which of the following would be a reasonable experimental strategy to prevent translation of a particular prokaryotic mRNA witho
    5·1 answer
  • Which change to a dna molecule would have the least effect on an organism?
    14·1 answer
  • Which system is responsible for the exchange of oxygen and carbon dioxide?
    14·2 answers
  • Which Florida county is home to Cape Canaveral Air Force Station? Kennedy
    6·2 answers
  • Clown fish have evolved resistance to the deadly stings of sea anemones. The sea anemone provides protection for the fish from p
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • It is possible for a mix up to occur between fictitious and factual information.
    13·2 answers
  • What would happen if the air didn't carry water ?
    8·1 answer
  • What is a chain of molecules linked with peptide bonds
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!