1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
likoan [24]
3 years ago
13

Which statement is true of all living things?

Biology
2 answers:
Alekssandra [29.7K]3 years ago
6 0
The correct answer among the choices presented above is option D. All living things come from other living things. This is supported by the cell theory where it states that all living things or organisms are made up of cells.Hope this answers your question.
N76 [4]3 years ago
5 0
D. They come from other living things

Explanation:
The cell theory states that all living things come from preexisting cells. 
You might be interested in
In an ecosystem how are animals connected?
aivan3 [116]

Answer:

A. the food web

Explanation:

Ecosystems have lots of different living organisms that interact with each other. The living organisms in an ecosystem can be divided into three categories: producers, consumers and decomposes. They are all important parts of an ecosystem. Producers are the green plants.

8 0
4 years ago
Which of these different ecological systems do we understand the least because of its size and complexity
lianna [129]

Answer:

i

Explanation:

6 0
3 years ago
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
How do dogs, bats, and raccoons transmit disease to humans?
Veronika [31]
Mostly through bites, I think.
6 0
3 years ago
Read 2 more answers
Volcanic eruptions, breathing, decaying dead matter, burning fossil fuels, and warm bodies of water are all carbon examples of w
kodGreya [7K]

Answer:

the answer is a

Explanation:

3 0
3 years ago
Other questions:
  • The atmospheres variable gases that most influence the green house effect are _________.
    6·1 answer
  • The "permanent" wave that your local beauty parlor offers depends critically on rearrangements in the extensive disulfide bonds
    5·1 answer
  • The clumping together of red blood cells by the action of an antibody is known​ as
    5·1 answer
  • 1. The Devonian period is considered the Age of Fishes. Would you expect
    9·1 answer
  • Why must all organisms carry out metabolism
    5·1 answer
  • Climate change on earth is thought to be affected by which of the following solar phenomena? A.solar eclipses B. solar flares C.
    11·2 answers
  • The suns energy is most useful to humans after it is converted to​
    10·1 answer
  • Traditional analysis of mutants (natural or induced) to determine gene function is known as _____.
    14·1 answer
  • A population of sixteen emu grew to thirty-nine in one year. After two years, the population had grown to forty-eight. The maxim
    13·2 answers
  • What is the mass of the atom below?<br> P: 27<br> W: 32<br> O 27<br> O 32<br> O 10<br> O 59
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!