1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatyana61 [14]
3 years ago
14

A student added a solution to the plant cell shown in image 1 which resulted in the plant cell undergoing changes, as shown in i

mage 2. What best directly explains the observed changes? A) The solution was isotonic to the cell and caused organelle lysis. B) The solution contained enzymes that degraded the DNA and proteins of the plant cell. C) The solution was hypotonic to the cell and caused an increase in turgor pressure as water entered the cell. D) The solution was hypertonic to the cell and caused water to leave the plant cells central vacuole and cytoplasm.
Biology
1 answer:
Alisiya [41]3 years ago
4 0

Answer:The answer is D

Explanation:

You might be interested in
What is the difference in homeostasis between plants and animals?
Crank

Answer: Humans and animals aren't the only ones who rely on homeostasis. Plants need to maintain the same balance in order to survive and thrive too. Like animals, plants also "breathe," though the exchange is the reverse of what we do. Plants take in carbon dioxide and release oxygen.

Explanation: trust

8 0
3 years ago
Which of these are characteristics of a scientific law? Check all that apply?
algol13
I think it's number 5
5 0
3 years ago
Două întrebări la sistemul respirator​
Viefleur [7K]

Answer:

How respiratory system works?

What are the components of respiratory system?

Explanation:

Our lungs expand when we breathe in through our nose and mouth. That air moves down our trachea, through your bronchi and into the bronchioles, where it enters your alveoli where blood capillaries are passes which load oxygen and unload carbondioxide gas which can be removed from our body through exhalation. Nose, mouth, throat (pharynx), voice box (larynx) , windpipe (trachea) , large airways (bronchi)  and lungs are the main components of our respiratory system.

3 0
3 years ago
If you were to decide to remove outlying data points from you analysis what are two ways you could indicate this in your report
Andrej [43]

Answer:

If the outlying data points are to be taken out from the report to guarantee the analysis of examination is right is to eliminate only if that isn't right or if there is enough data to check the data points once more.

One shouldn't eliminate outliers if the outcomes are critical and there are numerous outliers in data point. While eliminating the data points, one can trim the data points or change it with closest with mean or median.

4 0
3 years ago
The goal of transcription is to produce what
Igoryamba
The goal of transcription is to produce RNA copies of individual genes that the cell can use in the biochemistry. 
5 0
3 years ago
Other questions:
  • Maple syrup, which comes from the sap of maple trees, contains water and natural sugars. It's a clear, brown liquid and the suga
    6·1 answer
  • Samuel always receives a painful shock when he turns on the lamp in his study. after a while, samuel refuses to touch the switch
    9·1 answer
  • please help me with this does anyone know any of these please give helpful answers I need help with hw Please I'm in a hurry!!!!
    12·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which answer best explains the difference between protists and bacteria?
    11·1 answer
  • A population of 120 rabbits lives in a prairie ecosystem. Which of these might prevent this population from growing any larger?
    7·2 answers
  • according to this time table a train --------- at 3 o'clock .A will leave .B is leaving C. is going to ​
    9·2 answers
  • What molecule in your body would be responsible for Gathering and attaching nucleotides​
    7·1 answer
  • Which of these statements is correct about a scientific law?
    10·1 answer
  • Mimicry or camouflage ?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!