1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alinara [238K]
3 years ago
8

During meiosis, a defect occurs in a cell that results in the failure of microtubules, spindle fibers, to bind at the kinetochor

es, a protein structure on chromatids where the spindle fibers attach during cell division to pull sister chromatids apart. Which of the following is the most likely result of such a defect?A) New microtubules with more effective binding capabilities to kinetochores will be synthesized to compensate for the defect.B) Excessive cell divisions will occur resulting in cancerous tumors and an increase in the chromosome numbers known as polyploidy.C) The defect will be bypassed in order to and ensure normal chromosome distribution in the new cells.D) The resulting cells will not receive the correct number of chromosomes in the gametes, a condition known as aneuploidy.
Biology
1 answer:
mario62 [17]3 years ago
7 0

Answer:

The resulting cells will not receive the correct number of chromosomes in the gametes, a condition known as aneuploidy.

Explanation:

Formation of functional microtubule spindle fibers and their attachment to kinetochores of chromosomes is required to ensure their alignment st the cell's equator during metaphase. During anaphase, shortening of these microtubules pulls the chromosomes to the opposite poles. These events ensure the distribution of the correct number of chromosomes among the daughter cells. The presence of defective microtubules would not allow proper distribution of chromosomes to the daughter cells and would result in the presence of an abnormal number of chromosomes (aneuploidy).

You might be interested in
Polygenic traits are determined by multiple ______ received from each parent.
sweet [91]
The answer is: gene     
6 0
4 years ago
Read 2 more answers
What is a reducing sugar?
icang [17]
Reducing sugar is any sugar (all monosaccharides, some disaccharides, oligosaccharides, and polysaccharides) that is capable of acting as a reducing agent because it contains free aldehyde group or free ketone group.

Aldehyde group or alkanal is an organic compound containing formyl group. The formyl group is a functional group consisting of a carbonyl center bonded to hydrogen and an R group. This group can be readily reduced to primary alcohol with the help of catalyctic hydrogenation either applied directly or by transfer hydrogenation.

Ketone group unlike aldehyde group does not have a hydrogen atome bonded to the carbonyl group but it can still be hydrogenated.
4 0
3 years ago
Which of the following is NOT a natural resource?
Shalnov [3]

Answer:

D

Explanation:

Fire is man made because for there to be fire you have to strike a match or use other man made sources

4 0
3 years ago
The chart, the organism Rr represents a genetically _____________ individual.
Elodia [21]
Your answer is going to be  homozygous , the answer is C
8 0
4 years ago
Read 2 more answers
EXTRA POINTS FOR THIS
sergeinik [125]

Answer:

No

Explanation:

Matter can not be created or destroyed it can only change form. For example two Oxygen atoms can react with one hydrogen atom to form water but the oxygen and hydrogen is not destroyed,

3 0
3 years ago
Other questions:
  • The information in the table shows the possible genotypes resulting from the mating of two heterozygotes aadd. the allele a code
    8·1 answer
  • In ce consta importanta subciclului fiziologic al pasarilor migratoare
    9·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Why did camels evolve?
    14·1 answer
  • Please help me ~15points~<br> EXPLAIN WHAT HEAT INDEX IS?
    9·1 answer
  • Can someone please help me both of them
    14·1 answer
  • Someone please help me with this! I will mark brainliest please explain!!!
    6·2 answers
  • Linnaeus classified organisms into two kingdoms. How was his system of classification impacted after the invention of the micros
    12·1 answer
  • Which are physical properties? (Select all that apply.)
    5·2 answers
  • This article discusses a group of scientists who are studying an ecosystem. What ecosystem are the scientists studying?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!