1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vladimir2022 [97]
3 years ago
9

The graph illustrates what has happened over an 8 year period where non-native perch were introduced into Lake Malawi in Africa.

Environmental factors remained the same during this period (i.e. temperature, pH, water levels,etc) Based on the data, what recommendation would you make to African biologists?
A. Remove the remaining pike cichlids, as they are competing with the Nile perch.
b. Reduce both fish populations, or they will starve one another out.
C. There is not enough data to make a decision yet.
D. Remove or reduce the Nile perch as quickly as possible, as it is clearly outcompeting the pike cichlid
Biology
2 answers:
valentina_108 [34]3 years ago
5 0

Answer:

A

Explanation:

took the test

Dennis_Churaev [7]3 years ago
5 0

Answer:

A. Remove the remaining pike cichlids, as they are competing with the Nile perch.

Explanation:

You might be interested in
What happens if you put a magnet next to iron
kenny6666 [7]
Depends in the weight of tge objects, but they will be drawb together
3 0
3 years ago
Read 2 more answers
What is the cell cycle??
OLEGan [10]
The series of events that take place in a cell<span> leading to its division and duplication (replication) that produces two daughter cells. </span>
6 0
3 years ago
Read 2 more answers
The ____ phylum of seedless vascular plants has about 1000 known living species, including those in the genera
dalvyx [7]

Answer:

D)Lycophyta

Explanation:

The seedless vascular plants or the pteridophyte forms one phylum of the plant kingdom.  The pteridophyte kingdom can be classified into three groups: the Sphenophytes, the pteridophytes and the Lycophytes.

The Lycophyte group contains about 1000 living species as it is the most primitive group of vascular plants. The species is characterised by the presence of the microphyll like the Selaginella and Lycopodium.

The rhizoids of the gametophyte of these plants form the mycorrhizal association with the fungi.

Thus, Option-D is the correct answer.

3 0
3 years ago
Read 2 more answers
Is the penguin a bird?? please help <br> &lt;3
zvonat [6]

Answer:

Yes, it is.

Explanation:

Penguins are a species of seabird that lives in the southern hemisphere, in areas close to Antarctica, characterized by its cold and wide expanses of sea without land. In this context, penguins are capable of living in these temperatures and feeding on fish and other marine elements. In addition, they are unable to fly, but not so to move through the sea using their wings for it.

4 0
3 years ago
Which of the following rocks would most likely be formed from an erupting volcano
serg [7]
Igneous rocks are formed when the magma from an erupting volcano eventually cools this  rock is extrusive- found on the earth's surface.
6 0
3 years ago
Other questions:
  • A magnified cross-sectional view of a horsetail stem shows the tube-shaped cells of xylem. What is their function?
    9·1 answer
  • What are the different parts of an animal cell
    11·1 answer
  • Pepstatin binds to the enzyme pepsin, the chief digestive enzyme in the stomach. The substrate (a protein) is still able to bind
    14·1 answer
  • Cuales celulas se producen por meiocis
    15·2 answers
  • Which word is a homophone for scene? <br> a. scenery <br> b. scent <br> C. seen <br> D.sight
    9·2 answers
  • Hello! I have a question and I ask if you can make it a bit detailed. I am struggling to understand the Calvin Cycle in the proc
    9·1 answer
  • All carbonate minerals contain the elements_____
    14·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • What is the name of that have the ability to develop into differen kinds of cells?
    8·2 answers
  • Under conditions when there is very intense competition between memebers of the same species the distribution of individuals wil
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!