1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anastaziya [24]
3 years ago
11

What in the dna is the source of genetic variation

Biology
1 answer:
Setler79 [48]3 years ago
6 0

Answer:

Mutation i think.

Explanation:

You might be interested in
What is one thing that your teacher should know about you? What will help the
Maru [420]

Answer:

Ummm..... I'm not sure who you are but you can put this: My teacher should know that I work best in groups. The teacher can also give me respect, like I would to her.

3 0
3 years ago
Which cell organelle’s function resembles the function of the brain in higher animals?
raketka [301]
The nucleus resembles the brains function.
7 0
3 years ago
Three cousins have a similar appearance but different face shapes.
kozerog [31]

Answer:

C

Explanation:

Genes, choromosomes, and the nucleus (contains the DNA) are all apart of genetics.

4 0
2 years ago
Read 2 more answers
Chromosomes contain different amounts of:
Juli2301 [7.4K]

Answer:

DNA srry if im wrong

Explanation:

8 0
2 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • (last word) a study found that the incidence of skin cancer increases along with the amount of time people work under fluorescen
    5·1 answer
  • When the atoms in a covalent bonding relationship are not balanced, the molecule is said to be
    7·1 answer
  • Which is the best example of a hypothesis?
    10·1 answer
  • Angiosperms _____. have flowers have cones are nonvascular are seedless
    7·1 answer
  • All of the following occur during exercise in order to maintain blood glucose levels, except ______?a. Sympathetic stimulation c
    14·1 answer
  • What type of mutation results in frameshift mutation?
    13·1 answer
  • Which of the cell types shown is most associated with the production and flow of cerebrospinal fluid (CSF)?
    12·1 answer
  • What are the main sources of carbon dioxide in the<br> atmosphere?
    12·1 answer
  • What happens if the mass of the elements is greater compared to smaller ?
    12·1 answer
  • What does nitrogen fixation accomplish?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!