Answer:
In conditions of low or no oxygen the process of anaerobic respiration occurs. The 'an' in 'anaerobic' means without. During anaerobic respiration, the oxidation of glucose is incomplete - not all of the energy can be released from the glucose molecule as it is only partially broken down.
Explanation:
This would directly affect the epidermis because blisters will develop within the surface of the skin. Having blisters on the epidermis will decrease the function of the skin to be an effective barrier to disease. This is because blisters are open wounds that are prone to infection. As infection passes through these openings, it will affect the dermis and the other layers of the skin. Bullae is actually an auto-immune skin disease.
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer:
Concentration gradient
Explanation:
Concentration gradient of the ions across the membrane generates the membrane resting potential.
Concentration gradient means that there is unequal distribution of the ions on different sides of membrane. For example, the concentration of K ions is much higher within the cell then out of the cell. Opposite is with the Na ions. When ions move from the area of their higher concentration to the are with the lower concentration, we say they move down the gradient or diffuse (no energy required). On the other hand, movement of ions against their gradient means that this process requires energy and involves protein pumps.
its appendages are feathered
