1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
creativ13 [48]
3 years ago
7

Earl gets a commission of 20% on all sales. He sold $1,580.00 worth of goods. What was the amount of his paycheck?

Mathematics
2 answers:
mylen [45]3 years ago
5 0

Answer:

The answer is option C ; $316.00

Step-by-step explanation:

Earl gets a commission of 20% on all sales.

He sold $1,580.00 worth of goods.

So, his commission amount will be :

0.20\times1580=316 dollars

Therefore, the amount of his paycheck will be $316.

So, option C; $316.00 is the answer.

miv72 [106K]3 years ago
4 0
You need to find 20% of $1580.00.

20% of $1580.00 =

= 20% * $1580.00

= 0.20 * $1580.00

= $316.00
You might be interested in
×WILL MARK AS BRAINLIEST×<br>Solve the equation for b, d and x
Lera25 [3.4K]
Solve for d:
(3 (a + x))/b = 2 d - 3 c
(3 (a + x))/b = 2 d - 3 c is equivalent to 2 d - 3 c = (3 (a + x))/b:
2 d - 3 c = (3 (a + x))/b
Add 3 c to both sides:
2 d = 3 c + (3 (a + x))/b
Divide both sides by 2:
Answer: d = (3 c)/2 + (3 (a + x))/(2 b)


-----------------------------

Solve for x:
(3 (a + x))/b = 2 d - 3 c
Multiply both sides by b/3:
a + x = (2 b d)/3 - b c
Subtract a from both sides:
Answer:  x = (2 b d)/3 + (-a - b c)

____________________________


Solve for b:
(3 (a + x))/b = 2 d - 3 c
Take the reciprocal of both sides:
b/(3 (a + x)) = 1/(2 d - 3 c)
Multiply both sides by 3 (a + x):
Answer: b = (3 (a + x))/(2 d - 3 c)
5 0
3 years ago
PLEASE HELP ASAP
Igoryamba

Answer:

∠1 - 40°

Step-by-step explanation:

∠1 - 40°

b/c it's a right triangle and we have two angles given, 50° and 90°. Add them and subtract by 180° and get 40°.

∠2 - 140°

b/c an exterior (outside) angle is equal to the two most isolated / farthest angles added. The two most is angles are 105° and 35°, add them and get 140°.

∠3 - 40°

b/c ∠'s 1 and 3 are vertical angles meaning they're equal so since ∠1 is 40°, so is ∠3.

∠4 -

b/c ∠' s 2 and 4 are vertical angles meaning they're equal so since ∠2 is 140°, so is ∠4.

∠5 - 35°

b/c we have two angles, 105° and 40°. Add them and subtract by 180° and get 35°.

~~

I hope that helps you out!!

5 0
3 years ago
5. Find the change in temperature: from -1°F to -20°F
kap26 [50]

Answer:

-19

Step-by-step explanation:

7 0
2 years ago
Read 2 more answers
If cos(2/3x+20)°=sin(2x−10)°, find the acute angles of the corresponding right triangle.
adell [148]

Answer:

A = 40°

B = 50°

Step-by-step explanation:

If cos A = sin B, then A + B = 90

So, 2x/3 + 20  + 2x - 10 = 90

      2x + 60 + 6x - 30 = 270

               8x + 30 = 270

                       8x = 240

                          x = 30

2x/3 + 20 = 60/3 + 20 = 20 + 20 = 40

2x - 10 = 2(30) - 10 = 60 - 10 = 50  or  90 - 40 = 50

       

7 0
3 years ago
Aaron and his friends went trick or
sergeinik [125]

Answer:

4.472

Step-by-step explanation:

So we just have to divide

22.36 / 5 = 4.472

6 0
3 years ago
Read 2 more answers
Other questions:
  • HELP PLEASE!!!! A small tree was planted at a height of 8 feet. The tree has been planted for 14 months, and is now 52.8 feet ta
    5·1 answer
  • If fishmarket bought two swordfish at a rate of $13 per pound. The cost of the larger fish was three times as great as the cost
    8·2 answers
  • Emily just hired a new employee to work in your bakeshop. In one hour the employee burned 650 chocolate chip cookies. If this re
    15·2 answers
  • What is the supplement of an 87 angle ?
    7·2 answers
  • What are the 2 square roots
    15·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • V2=u2+2as v 2 = u 2 + 2 a s Where v v is the final velocity (in m/s), u u is the initial velocity (in m/s), a a is the accelerat
    13·1 answer
  • Rewrite the following in the form
    5·1 answer
  • Please help me find the length of EC
    12·1 answer
  • A person can pay $30 dollars for a membership to the science museum and then go to the museum for just $7 per visit What is the
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!