1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Keith_Richards [23]
3 years ago
5

What is the difference between a conductor and an insulator?

Biology
1 answer:
Yanka [14]3 years ago
8 0

Answer:

<h2>The Answer Is B</h2>

Explanation:

I took the test

You might be interested in
What is not a negative side effects of the escalating costs of malpractice insurance?
makvit [3.9K]
<span>Care providers paying higher malpractice insurance will be deterred even more from committing malpractice. They will take measures to assure this.</span>
7 0
3 years ago
Transport proteins———-
taurus [48]

Answer:

A transport protein is a type of protein that helps an organism move other materials around. Transport proteins are essential for all living organisms' development and survival. Transport proteins come in a variety of shapes and sizes.

<u>OAmalOHopeO</u>

<u />

7 0
3 years ago
Read 2 more answers
What does muscle tissue do?
Oliga [24]
Muscle tissue is the outer layer that protects your muscles and helps them to move without falling off.
4 0
3 years ago
Carbohydrates stored in the liver are in the form of starch.<br><br> True<br><br> False
Rufina [12.5K]

Answer:

It is false. carbohydrates are stored in form of glycogen.

3 0
3 years ago
Read 2 more answers
Repressors are transcription factors that bind to _____________sequences in dna
Trava [24]

Answer:

The given blank can be filled with operator.

Explanation:

The proteins that assist in turning on or turning off the function of a specific gene by getting combined with certain sections of the DNA are known as transcription factors. The transcription factors that activate the transcription of a specific gene are known as activators, while that prevents transcription and is termed as repressors.  

A repressor can be an RNA or a DNA binding protein, which prevents the articulation of genes by getting combined with the operator. A repressor, which binds with DNA prevents RNA polymerase from getting combined with the promoter, which further inhibits the transcription of the genes into mRNA.  

6 0
3 years ago
Other questions:
  • Stem cell research could lead to medical cures. Stem cell research probably would not benefit
    14·2 answers
  • Name a few plant dieases caused by bacteria
    5·2 answers
  • What is one reason cells remove waste?
    5·1 answer
  • Nuclear power is a major contributor to global warming.
    6·1 answer
  • When members of a species become separated by geography and lose the ability to interbreed, how would scientists classify them?
    8·2 answers
  • Near shore, larger sand and gravel particles are moved along the ocean bottom by _____.
    11·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Which space object releases the most electromagnetic radiation?
    6·1 answer
  • What is a polar molecule?
    13·2 answers
  • A group of scientists has recently created a strawberry with a new mutation. This mutation causes the strawberry plant to produc
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!