1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marysya [2.9K]
3 years ago
11

Scientific models can never be changed.

Chemistry
1 answer:
sweet [91]3 years ago
3 0
Thats false cause even the scientific models from now r continually changing before our very eyes yes some do stay the same but most change
You might be interested in
Which of the following groups of materials would
Nikitich [7]
The wrong answers for sure are B and D, I assume the answer is C
4 0
3 years ago
Read 2 more answers
What determines how fast a substance will dissolve
Blababa [14]

Answer:

(1) the surface area of the solute,

(2) the temperature of the solvent,

(3) the amount of agitation that occurs when the solute and the solvent are mixed.

Explanation:

8 0
4 years ago
Read 2 more answers
Chemistry help! Thanks to anyone who helps!
zmey [24]
A: 2-methyl-2-propanom
5 0
3 years ago
4 HF(g)+SiO2(s) → SiF4(9)+2 H2O(9) <br> Is the Si oxidized or reduced?
Airida [17]

Answer:

Si is reduced since it loses the oxygen atom

8 0
3 years ago
Which of the following is most likely a chemical reaction?
masha68 [24]

Answer:

Two solid powders are combined and shaken. The substances form a mixture.

4 0
3 years ago
Other questions:
  • 10) A hydrobromic acid (HBr) solution has a molar concentration of 0.0085 M. Calculate the
    9·1 answer
  • A textbook measures 250 mm long, 225 mm wide and 50 mm thick. What is the volume of this book in mm3? What is the volume of this
    8·1 answer
  • If a fish gets squirted with ink it will swim slower
    8·1 answer
  • 6.54g is how many mg
    8·1 answer
  • Which substance can not be broken down by a chemical change?(1) ammonia (2) methanol (3) propane (4) phosphorous
    5·2 answers
  • Which action could cause a sample of liquid to boil?
    10·2 answers
  • In P plants the gene for the color of the sea has two alleys in the punnets square show me love the dominant alley Y represents
    12·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • A can of butane with a pressure of 2 atm at 283k has its pressure increased to a new pressure of 5 atm. What is the temperature
    13·1 answer
  • How would adding the catalyst nitrogen monoxide (NO) affect this reaction?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!