1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Diano4ka-milaya [45]
2 years ago
8

How is hemoglobin's affinity for oxygen affected by the presence or absence of oxygen? rank hemoglobin molecules with the descri

bed conditions from most likely to bind oxygen molecules to most likely to release oxygen molecules. (for help approaching this problem, open hint 1.)?
Biology
2 answers:
Leya [2.2K]2 years ago
8 0
<h3><u>Answer;</u></h3>

In order from the most likely to bind an oxygen to least likely;

3 bound o2, po2=100mmhg1 bound o2, po2=100mmhg3 bound o2, po2=40mmhg1 bound o2, po2=40mmhg

<h3><u>Explanation;</u></h3>
  • Haemoglobin is more likely to bind oxygen if its other oxygen binding sites have already bound to an oxygen molecule.
  • The higher the partial pressure of oxygen in the blood also makes it more likely that the hemoglobin will bind oxygen.
Snowcat [4.5K]2 years ago
4 0

Hemoglobin is a protein-rich in iron that has an affinity (combining ability) to oxygen and with oxygen, it forms oxyhemoglobin in red blood cells. The amount of hemoglobin in normal blood is 15 grams per 100 ml of blood, and the hour is usually called "100 percent".

<h2>Further Explanation</h2>

Hemoglobin is a substance found in red blood cells. Hemoglobin is actually a globular protein in the form of 4 subunits, and each subunit contains hame.

Hemoglobin plays an important role in oxygen transport as long as it can re-bind oxygen. Hemoglobin tends to bind oxygen when the environment is full of oxygen and releases oxygen in a relatively low oxygen environment. This means hemoglobin takes oxygen in the lungs and releases it to tissues such as active muscle. In people who have normal hemoglobin, the capacity of the blood carries about 20 mL of oxygen per 100 mL of oxygen. In almost all situations, blood contains a lot of oxygen as it moves through the lungs.

Hemoglobin is carried by circulating red blood cells (erythrocytes). This circulation rotates for about 10 days containing approximately 3 x 10 red blood cells. A rough estimate of blood hemoglobin levels can be obtained from the amount of hematocrit or from the amount of blood by consuming each red blood cell that has normal hemoglobin

The heat produced by the metabolism reaction of muscle contractions releases a lot of acid & heat causes the body temperature to rise and the active cells need a lot of O2 to spur the release of O2 from OxyHb (Hb affinity towards O2 decreases) the curve shifts to the right.

Hypothermia causes slow cell metabolism so that the O2 needed by the tissue to release a small amount of O2 from Hb is also slow (Hb affinity for O2 decreases) and the hemoglobin oxygen dissociation curve shifts to the left.

Learn More

affinity Hemoglobin for O2 brainly.com/question/12365661

oxygen transport brainly.com/question/10280839

Details

Class: High School

Subject: Biology

Keywords: hemoglobin, affinity, oxygen

You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
Susan sat out in the sun watching a baseball game. She developed small blisters on her unprotected shoulders and neck. What type
Simora [160]

Second-degree burn is the type of burn represented by the formation of the blisters.

Second-degree burn is a burn that affects the epidermis and the superficial part of the dermis layer (skin). Second-degree burn may be caused by sunburn, chemicals, scald injuries, flames or electricity. The burn site may appear blistered, red, wet and shiny, and may be swollen and painful.


8 0
3 years ago
A 3 base section of mRNA. The ribosome reads 1 codon at a time; translation of a new protein always begins with _________, or Me
lukranit [14]

Answer:

The start codon is AUG

Explanation:

A three nucleotide sequence (represented with bases) of a DNA or a RNA which translates to a specific amino acid is referred to as codon. To begin the translation into a new protein, the first three nucleotide is always AUG (called the START codon) which is the codon for methionine.

NOTE: AUG is the initial of the bases; Adenine, Uracil and Guanine

7 0
3 years ago
Why are shape, weight, mass, size,<br> and texture NOT considered properties?
goldenfox [79]

Answer:

Density is an intensive property. This means that regardless of the object's shape, size, or quantity, the density of that substance will always be the same. ... It is because density in an intensive property of matter. So they are not considered properties.

Explanation:

8 0
2 years ago
Dr. Hodges notes that David's exhaled carbon dioxide levels are elevated. List all the metabolic pathways that function to synth
Mrrafil [7]

Answer:

Explanation:

The production of ATPs for skeletal muscle contraction  depends on the conditions that the muscles are exposed to.

In presence of abundant oxygen, to the cells  Aerobic respiration-cellular respiration is the most ideal. 32 ATPs and 4 C02 are produced as by-products during the process as by products majorly two C02 from each  of the 2 acetyl Co A that enters the  kerb's cycle.

Likewise direct phosphoryaltion of ADP to ATP gives 32.0 kj/mol of heat liberated but no C02 was produced. This takes place during chemiosmosis. with 28ATPs produced.

In absence of oxygen, anaerobic respiration of skeletal muscles produced ATPs  from  glycolysis, heat and  2C<u>02 as products, but not as by-product</u>.Through alcoholic fermentation pathway.

Therefore ,the correct answer is Aerobic respiration, because it gives out C02 which is a by-product, released out of the body as waste from the lungs,and not use up  in  the body.

3 0
3 years ago
Other questions:
  • How does the pupillary response prevent injury? What would happen without it?
    11·1 answer
  • When pink snapdragons are crossed with white snapdragons, what color will the offspring be?
    10·2 answers
  • What mineral is mined in the Congo and used in cell phones?
    11·1 answer
  • What are the parts of hair and what does each part contain
    12·2 answers
  • What crops are grown in france<br><br> Help!!
    8·1 answer
  • What are the steps to scientific method
    7·1 answer
  • DNA has two strands.If the sequence of the nucleotides of one strand was known,is it possible to use that information to determi
    14·1 answer
  • Que tipo de relación existe cuando una especie que utiliza a otra como vivienda
    5·1 answer
  • Help me, it's due today
    5·1 answer
  • Please help! ASAP AND THANK YOU!
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!