Answer:
Men express all the X-linked genes present in their genome.
Explanation:
Human males have one copy of X and one copy of Y chromosomes. They express all the alleles present on their X chromosome irrespective of its dominant or recessive nature. This occurs because males do not have a second copy of the X chromosome to carry another allele for the same gene. Color blindness is caused by a recessive allele present on the X chromosome. Males carrying one copy of this allele exhibit the disease while females need two copies of the allele of color blindness to express the disease. Therefore, males are more frequently affected by this disease.
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT
These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
Answer:
As the ice melts in the arctic regions, the arctic sea levels and the other oceans stay the same. The weather however changes when this happens and results to the Greenland's melting ice sheet adding another 20 feet to sea level rise.
In summary, the melting of polar ice caps effects would result in sea levels rising around 220 feet or more worldwide.
This will lead to destruction of lives, houses and properties due to water submersion.
The Krebs cycle<span> occurs right after glycolysis. The substance that begins the </span>Krebs cycle<span> is a 3-carbon molecule called pyruvic </span>acid<span>. The process breaks down the pyruvic </span>acid<span> into acetyl coenzyme A, releasing one of the carbon atoms into carbon dioxide.
hope it help</span>
