1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Free_Kalibri [48]
3 years ago
15

Sexually transmitted infections can be passed through which type(s of contact? kine 198

Biology
1 answer:
Marizza181 [45]3 years ago
8 0
The correct answer would be petting infected areas, vaginal intercourse, oral intercourse, and intercourse.

Glad i could help(:
You might be interested in
Hemoglobin is a protein in the blood that is made of 4 polypeptide chains. Two alpha chains are composed of 141 amino acids each
Ghella [55]
Amino acid differs at the glutamine, which is converted to valine in hemoglobin S. the body produced hemoglobin S due to a point mutation in the DNA sequence which results in different amino acid to be formed during translation of DNA sequence codons.
8 0
3 years ago
HELP!!!! Restriction maps illustrate the lengths of DNA fragments between restriction sites. Which of the following information
balandron [24]
The wording of this is confusing. I think it’s A and B and I’m hesitant say that it’s also C but only if you know the mutation and the gene.

Also for A you would only know a partial sequence of the gene.
6 0
3 years ago
PLEASE HELP!! 36 POINTS!!!
Serhud [2]

Answer:

Natural selection can cause microevolution (change in allele frequencies), with fitness-increasing alleles becoming more common in the population.

Fitness is a measure of reproductive success (how many offspring an organism leaves in the next generation, relative to others in the group).

Natural selection can act on traits determined by alternative alleles of a single gene, or on polygenic traits (traits determined by many genes).

Natural selection on traits determined by multiple genes may take the form of stabilizing selection, directional selection, or disruptive selection.

Introduction

We've already met a few different mechanisms of evolution. Genetic drift, migration, mutation...the list goes on. All of these mechanisms can make a population evolve, or change in its genetic makeup over generations.

But there's one mechanism of evolution that's a bit more famous than the others, and that's natural selection. What makes natural selection so special? Out of all the mechanisms of evolution, it's the only one that can consistently make populations adapted, or better-suited for their environment, over time.

You may have already seen natural selection as part of Darwin’s theory of evolution. In this article, we will dive deeper – in fact, deeper than Darwin himself could go. We will examine natural selection at the level of population genetics, in terms of allele, genotype, and phenotype frequencies.

Quick review of natural selection

Here is a quick reminder of how a population evolves by natural selection:

Organisms with heritable (genetically determined) features that help them survive and reproduce in a particular environment tend to leave more offspring than their peers.

If this continues over generations, the heritable features that aid survival and reproduction will become more and more common in the population.

The population will not only evolve (change in its genetic makeup and inherited traits), but will evolve in such a way that it becomes adapted, or better-suited, to its environment.

Explanation:

Here's my notes, i used and got it correct.

5 0
2 years ago
Amphibians moved to a terrestrial environment; however, they did not evolve the ability to live their entire lives on land. Expl
Gekata [30.6K]

Answer:

See the answer below

Explanation:

<em>Amphibians are not totally adapted to live on land because the aquatic environment is needed for several life processes such as </em><em>reproduction</em><em>, </em><em>respiration</em><em>, and sometimes, </em><em>feeding</em><em>.</em>

<u>The eggs of amphibians are without any protective shells and will suffer desiccation in the terrestrial environment. Hence, water is needed in order to protect the eggs. In addition, the male am</u>phibians shed their sperm in the water close to the female eggs.

<u>The young ones of amphibians are essentially aquatic and may not survive out of water for a long time because they only breathe gills</u> - the lung is yet to develop or poorly developed at this stage. They have to grow and develop to a certain stage in water before they can start surviving on land.

3 0
3 years ago
What is the differhence between food web and food chain
vazorg [7]
Food webs are more complex than food chain
8 0
3 years ago
Other questions:
  • What is the speed of a golf ball that moves 35 meters in 5 seconds
    9·1 answer
  • Fish developed many characteristics for survival. Match the parts of the fish to their correct functions.
    5·1 answer
  • You have bandaged a victim's lacerated elbow. Blood is still soaking through the dressing and bandage. What should you do?
    8·1 answer
  • Metabolites are small molecules that:
    13·1 answer
  • Where are the sensors for the arterial baroreceptor reflex located?a. cardiovascular centers in the medulla oblongatab. The symp
    14·1 answer
  • Which of the following items may be on the laboratory bench to while doing la work?
    11·1 answer
  • What are some basic steps to saving tropical rainforests? (Site 1)
    8·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Question 1 (5 points)
    6·1 answer
  • Sarah recently learned that o2 is found in the earth’s water bodies. she was amazed to know the proportion of o2 found in the oc
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!