1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GenaCL600 [577]
3 years ago
6

Which is an example of how stem cells are currently being used? for generating healthy cells to form replacement organs like bra

ins for directing differentiation to treat diabetes and arthritis for testing for possible side effects of a new cancer medication for curing heart disease by regenerating damaged heart tissue
Biology
2 answers:
Simora [160]3 years ago
6 0

for curing heart disease by regenerating damaged heart tissue

Stem cells are commonly used for the tissue repair process and they have the potentials to develop into different cells type in the body during early life and growth. Thus, stem cells in many tissues can function as internal repair system by dividing essentially without limit to replenish other cells as long as the person or animal is still alive. Furthermore, they mediates diverse role in disease progression, development and tissue repair processes in host.

Sunny_sXe [5.5K]3 years ago
5 0

Curing heart disease by regenerating damaged heart tissue.

You might be interested in
Protein disulfide isomerase (PDI) is a protein folding enzyme that catalyzes disulfide–sulfhydryl exchange reactions. Ribonuclea
lakkis [162]

Answer:

The effect of protein disulfide isomerase on insulin signifies that the active conformation of insulin is not the most thermodynamically favored form. The main reason behind this is that the protein disulfide isomerase seems to decline the free energy, that is, it makes them more steady form predominant.  

In the case of insulin, the prevalence of the stable form results in its inactivation. Thus, it signifies that the active form is not thermodynamically stable.  

3 0
3 years ago
27. What adaptation do organisms that live in an estuary have?
Kamila [148]
The answer is B, or They can survive in changing salinity.
7 0
2 years ago
Read 2 more answers
What is the function of the eight major structures of a plant cell
otez555 [7]

Answer:

plant cell

Explanation:

1.cell well-protected and provides structural support of cell

2.cell membrane regulates entries and entries of substances within the cell.

3.nucleus stores DNA

4.plastids they store starch help in photosynthesis

5.chloroplast pigment which protect cell

6.vacuole sustain turgid pressure against cell wall

7.mitochrondria provide energy to help break carbs

8.lysosome help with cellular waste disposal

5 0
3 years ago
A common concern for beer brewers making sour beers is contamination from Acetobacter. This organism converts ethanol to acetic
wolverine [178]

Answer:

C. Ethanol, ammonium chloride, phosphate buffer, magnesium sulfate, calcium chloride, trace elements

Explanation:

Acetobacter must have a sufficient supply of oxygen and cannot grow in its absence. Colonies of acetobacter can be detected by a culture media containing ethanol as carbon source, the acid produce by the bacteria will dissolve the chalk thereby leaving a clear zone around the colony.

7 0
3 years ago
Read 2 more answers
A reversible inhibitor that only affects multi substrate enzymes and binds to the enzyme only after one substrate has bound is a
photoshop1234 [79]

Answer:  

Uncompetitive inhibitor.

Explanation:  

Enzymes are the biological catalysts that catalyze the biological process and metabolic activity of the body. Without enzymes, all the biological activity becomes very slow. Enzyme provides suitable speed for the biological process. All enzymes are made up of protein. The uncompetitive inhibitor is the type of enzyme that only disturbs or affects multi-substrate enzymes and joins to enzymes only after one substrate has bound.  

8 0
3 years ago
Other questions:
  • What is the term for the portion of the earth's atmosphere, hydrosphere, and geosphere where life is found?
    5·1 answer
  • Compare the process of chemiosmosis during cellular respiration versus during photosynthesis. Include the source of electrons, t
    14·1 answer
  • How many moles of MgCI2 are there in 309 g of the compound
    15·1 answer
  • Where are mid-ocean ridges found? What do the mid ocean ridges tell us about plate motion?
    9·1 answer
  • Listen
    5·1 answer
  • What type of cells are used to seek and destroy pathogens?
    10·2 answers
  • Deciduous vegetation can play a large role in building design as a result of its ability to: a. increase interior lighting level
    13·1 answer
  • HELPPPPPPPP FASTTTTTTTTTTT NOWWWWW
    8·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • say you are a scientist that wants to find out how fast lobsters grow at different environmental variables. which experiment wou
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!