1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nadezda [96]
4 years ago
12

Do rainforests have seasons?  if do What are they?

Biology
2 answers:
Serjik [45]4 years ago
5 0
Wet season and dry season ♥️
Alik [6]4 years ago
3 0
They don't have seasons like spring and summer but they have something called a wet and a dry season. 
You might be interested in
Which of the following statements about natural selection is TRUE?
diamong [38]

Answer:

A. Natural selection results in those individuals within a population who are best-adapted surviving and producing more offspring. The traits that promote survival are heritable.

Explanation:

Natural selection works on the genetic variations that are already present in the natural populations. Some organisms of a population are more likely to produce more offspring than the others. This is due to the presence of beneficial genetic traits in these individuals that impart survival and reproductive fitness to them. Natural selection favors those individuals. Over the generations, the frequency of the beneficial genetic trait in the population increases.

5 0
3 years ago
Помогите срочно!!! <br> Умоляю
Alexxandr [17]

огите срочно

Explanation:

6 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
A farmer wants to reduce the need for pesticides at his farm. What should he do? A. Practice conservation tillage. B. Use benefi
bezimeni [28]

Your correct answer is B.)

4 0
4 years ago
Read 2 more answers
Explain how the triplet code of dna is transcribed and translated in the synthesis of proteins
timama [110]
Ok this is going to be a long answer lol


Translation is the process by which a protein is synthesized from the information contained in a molecule of messenger RNA (mRNA). During translation, an mRNA sequence is read using the genetic code, which is a set of rules that defines how an mRNA sequence is to be translated into the 20-letter code of amino acids, which are the building blocks of proteins.



During transcription, the DNA of a gene serves as a template for complementary base-pairing, and an enzyme called RNA polymerase II catalyzes the formation of a pre-mRNA molecule, which is then processed to form mature mRNA

I hope this helps :)
4 0
3 years ago
Other questions:
  • Over the last several decades, scientists have addressed the problem of nonrenewable natural resources such as fossil fuels. Hum
    11·2 answers
  • Why do the cells in all living things need energy
    9·2 answers
  • Classify each item as being associated with light positioning (controlling how and where light strikes the retina) or sensory pr
    5·1 answer
  • Which of these examples might be an animal adaptation to life in the tree canopy of a tropical rainforest?
    11·2 answers
  • Wearing at joints at certain points on the skeleton can give you clues about the person's: A. Height B. Weight C. Gender D. Age
    10·1 answer
  • "The following are genotypes of merozygotes of E. coli with various combinations of lac operon mutations. Determine the phenotyp
    12·1 answer
  • Which nonmetallic, white mineral cleaves in one direction and feels greasy?
    6·1 answer
  • This type of air pressure is associated with warm air rising
    11·2 answers
  • How are a desert and a tundra similar? (100 points) BRAINLIEST will be given!
    7·1 answer
  • Which two things should the scrum team do during the first sprint?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!