1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
shutvik [7]
3 years ago
12

Part E

Biology
1 answer:
Colt1911 [192]3 years ago
5 0

Answer:

The subject definition has always been listed in the overview section elsewhere here.

Explanation:

Something you are attempting to calculate is a variable. It can be something, such as things, quantities of time, emotions, actions, or thoughts. If you're researching how people here feel regarding specific tv programs, television shows as well as emotions are the factors throughout the analysis. If you are learning how various forms of fertilizer influence how tall plants develop, fertilizer form and plant height seem to be the variables.

<u>Independent Variable</u>

  • The independent variable seems to be the variable whom the adjustment is not influenced throughout the analysis by every other variable. Usually, the researcher herself needs to modify the independent variable or it adjusts by itself because nothing influences or adjusts this one in the project.

<u>Dependent Variable</u>

  • Throughout the analysis, the dependent variable that's what's being examined but instead evaluated. As something of a consequence of the modifications to something like the independent variable, that's what modifications.
You might be interested in
Select the correct answer from each drop-down menu. Alma is walking in a park. Suddenly, a wild dog charges toward her. Alma is
zaharov [31]

Answer:

when she sees the dog charging towards her her eyes sees it and sends message to the brain and then brain gives the response to run away but after running sometimes she realises that she has left the dog far so her brain responds to slow down so, after a while her heart beats also slow down.

<em><u>hope</u></em><em><u> </u></em><em><u>it helps</u></em><em><u>.</u></em><em><u>.</u></em>

4 0
3 years ago
10. If a woman with Type A blood has a child with a man with Type B blood and their first child has
LekaFEV [45]

Answer:

Genotype of woman - AO

Genotype of man - BO

Explanation:

O is recessive so if A or B is present, it will mask the O and the blood type will be either A or B

7 0
3 years ago
Plzzz help meee ! identify science vs. pseudoscience
enot [183]
Science follows the evidence where it leads, and pseudoscience starts with the conclusion, and works backwards to confirm it
8 0
3 years ago
Read 2 more answers
Why is a complex food web better than a simple food chain for the survival of the community?
ziro4ka [17]
Food web provides a better model of an ecosystem and model of many different consumers
5 0
3 years ago
Which of these is a common characteristic of cnidarians?
irina [24]
I believe the answer is C. They are a type of jelly fish.
5 0
4 years ago
Read 2 more answers
Other questions:
  • How many cells does a fungi have?
    14·2 answers
  • Twind is considered to be an abiotic factor because it.?
    12·1 answer
  • 1. Divergent boundaries are characterized by explosive lava flows. True or False
    6·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • How can Microscopic protists and fungi be characterized
    6·1 answer
  • Which of the following accurately identifies the chemical basis of Chargaff's rule?
    15·1 answer
  • Which cell lacks a nucleus?<br> Muscle cell<br> Euglena<br> Fungal cell<br> Bacterial cell
    5·2 answers
  • The genotype of individual 2 could be
    6·1 answer
  • HELPP I NEED SOME ANSWERS PLEASE ILL GIVE BRAINLIEST!
    11·1 answer
  • In the process of nitrogen fixation,__________ Convert ___________ To forms of nitrogen that plants can use.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!