1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
____ [38]
3 years ago
5

Match the functional groups with their structures:

Biology
1 answer:
evablogger [386]3 years ago
7 0
The true answer of your question is :

OH : HYDROXYL GROUP

NH2 : AMINO GROUP

CH3 : METHYL GROUP ( but in rather broader terms, that functional group of formula CnH2n+1 where n is an integer is called ALKYL GROUP where by substituting n by 1,2,3... we obtain methyl for n = 1, ethyl for n = 2, and propyl for n = 3 )

COOH : CARBOXYL GROUP is the correct answer since carbonyl is characterized by the presence of functional group C=O in general the formula of the compound would be
R-C=O-R’ where R and R’ are alkyl groups like methyl for example. However the carboxyl group could be thought of as a summation of carbonyl + hydroxyl ( CO + OH ) resulting thus in COOH.

I hope you’ll understand everything, anyway if not i’m always here to help. ♥️
You might be interested in
Summarize symbiosis.
Illusion [34]

Answer:

Symbiosis is a close relationship between two species in which at least one species benefits. Mutualism is a symbiotic relationship in which both species benefit. Commensalism is a symbiotic relationship in which one species benefits while the other species is not affected.

5 0
2 years ago
Chromosomes are strands of ADN wrapped around​
babymother [125]

Answer:

In the nucleus of each cell, the DNA molecule is packaged into thread-like structures called chromosomes. Each chromosome is made up of DNA tightly coiled many times around proteins called histones that support its structure.

3 0
2 years ago
Most atp in cellular respiration is regenerated in substrate level phosphorylation. most atp in cellular respiration is regenera
algol [13]

Answer: False

In cellular respiration, <span>organic molecules are break down and it uses an electron transport chain for the production of ATP through oxidative phosphorylation. Here, the hydrogen ions are pumped into the mitochondrial intermembrane space and they flow back through ATP synthase that produces most of the ATP associated with cellular respiration.</span><span>


</span>

5 0
3 years ago
Membrane-bound organelles are NOT found in cells of
elixir [45]
Animals because that is not part of a cell house
3 0
2 years ago
Which statement about water pollution is TRUE?Question 80 options: Air pollution can cause water pollution. There is a short lis
Aleksandr-060686 [28]

Answer:

Option A. Air pollution can cause water pollution.

Explanation:

Substances can permeate into the water from the air.

6 0
2 years ago
Other questions:
  • Does salt dissolve in water if it does why
    11·2 answers
  • The genotype represents _____. a paired combination of genes either a dominant or recessive gene a given phenotype two alleles
    15·2 answers
  • Which choice is NOT part of the circulatory system?
    5·1 answer
  • explain some of the various medieval literary forms. why were writers employing these literary forms?​
    12·1 answer
  • Jasmine is healthy girl who is playing outside. Her internal body temperature rises to 38°C, which is above normal.
    10·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • What was significant about the fossils Darwin found?
    7·2 answers
  • What picture best describes the function of the organelle "chloroplast" for example a cell membrane describes its function to a
    6·1 answer
  • How do sea anemones benefit from their relationship with clownfish?
    14·1 answer
  • What is the greatest advantage of using different methods that result in the same outcome?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!